Skip to main content

Table 1 Cervus elaphus primer sequences

From: Innate immune markers that distinguish red deer (Cervus elaphus) selected for resistant or susceptible genotypes for Johne’s disease

Target Primer sequence (5' to 3') Amplicon size (bp) Accession number
Β2M forward GGCTGCTGTCGCTGTCT 75 DQ482731.1
Β2M reverse TCTGGTGGGTGTCTTGAGTACA
PPIB forward TGGCTACAAAGACAGCAAATTCC 148 NM_174152.2*
PPIB reverse CCAGGCCCATAATGTTTAAGCT
iNOS forward GAAGAGGCTGAGAAGCAGAGGTT 98 NM_001076799.1*
iNOS reverse TCCAGCACCTCCAGGAATGT
IL-1α forward ATCCACGAGGAATGCATCCT 147 EU860100.1
IL-1α reverse AGAATCCTCTTCTGATACATAAGCAACA
TNF-α forward AGGGAAGAGCAATCCCCAACT 123 U14683.1
TNF-α reverse CTGAGCGTTGATGTTGGCTACA
IL-23p19 forward GATGTCCCCCGTATCCAGTGT 114 EU860097.1
IL-23p19 reverse CAGCAGCTTCTCGTAAAAAACCA
IL-12p35 forward GCCTCAACTACTCCCAAAACCT 83 U57751.1
IL-12p35 reverse GCAGGAGTAAAATTCTAGGGTTTGTC
IL-10 forward CGGTGGAGCAGGTGAAGAG 71 U11767.1
IL-10 reverse AAACTCACTCATGGCTTTGTAGACA   
  1. * Accession number for corresponding bovine gene which was used to BLAST search the AgResearch Cervine Sequence Database to obtain cervine sequence from which to design primers.