Skip to main content

Table 1 The PCR primers used for detection and qPCR of transgenic cells and mice

From: Transgenically mediated shRNAs targeting conserved regions of foot-and-mouth disease virus provide heritable resistance in porcine cell lines and suckling mice

Name Sequence Function
GFP-F GGTCTTGTAGTTGCCGTCGT Quantitate GFP in BHK-21 cells
GFP-R TCGTGACCACCCTGACCTAC
h-actin-F CACGCAGCTCGTTGTAGAAG Quantitate β-actin in BHK-21 cells
h-actin-R AGGACTCGTACGTGGGTGAC
PBL1-F CAACATACGAGCCGGAAGCATAAA Detect PBL in cell lines
PBL1-R TAACAGAATCTTGACCTTGCCACA
PBR1-F AGTCAGTCAGAAACAACTTTGGCACA Detect PBR in cell lines
PBR1-R ACGAATAGGTGGCCTATGGCATTATTG
PBase-F GCCACCATGGGATGTTCTTTAG Detect transposase in cell lines
PBase-R GTACTCAGAAACAACTTTGGC
Q-PBR1-F TACGCATAAACGATGACG Quantitate copy number in cell lines
Q-PBR1-R CAAACTAAAGGCGGAGTG
Neo-2B-F TGACCGCTTCCTCGTGCTTT Detect transgenic mice
Neo-2B-R TGGGTGTTCCCGCCTAGTGA
3D-Neo-F ATCCGACGCCGCCATCTCTA Detect transgenic mice
3D-Neo-R CGGAGAACCTGCGTGCAATC
NR-F CGTTTCGCATGATTGAACAAGAT Quantitate copy number in mice
NR-R GTGCCCAGTCATAGCCGAAT
GI-F GGTGGTGAATACCATGTACAAAGCT Quantitate GAPDH as reference in mice
GI-R CCAACACCCCCAGTCATACG