Skip to main content

Table 1 Sequences of oligonucleotides.

From: Transposon mutagenesis in Mycoplasma hyopneumoniae using a novel mariner-based system for generating random mutations

Oligonucleotide Restriction sites Oligonucleotide sequence (5’-3’)
TetM1 Pst I GCCGCTGCAG AATTAAAAGTTAGTG
TetM2 Xba I GAAATCTAGA TTATATAACAACTTAAATTAC
TetM3 Sbf I CGATCCTGCAGG CAGAATTAAAAGTTAGTG
TetM4 Mlu I CAGTACGCGT TTATATAACAACTTAAATTAC
Tpn1 Nde I/NcoI GCGCATATGCCATGG AAAAAAAGGAATTTCGTG
Tpn2 Xho I CGCCACTCGAG ATTATTCAACATAGTTCCCTTC
P97-1 Nde I CGATCATATG ACGGGGATTTAAAACAGAAAC
P97-2 Nco I GAATCCATGG CACCAACAATTCCGGCAGTC
TetMF N/A GTGGACAAAGGTACAACGAG
TetMR N/A CGGTAAAGTTCGTCACACAC
Linker-A N/A CGACTGGACCTGGA
Linker-B N/A GATAAGCAGGGATCGGAACCTCCAGGTCCAGTCG
L-PCR-C N/A GATAAGCAGGGATCGGAACC
L-PCR-L N/A GATAGGGTTGAGTGTTGTTC
L-PCR-R N/A TAGTCGGATAGATAAAGTAC
  1. Sequences of oligonucleotides used in the study are shown. Where appropriate, the restriction enzyme recognition sites added to the 5’ end of the oligonucleotides are underlined.