Skip to main content

Table 1 List of primers used in this study

From: Repertoire of Escherichia coli agonists sensed by innate immunity receptors of the bovine udder and mammary epithelial cells

Gene

Primer ID

Primer sequence

Size of amplicon

Annealing temperature (°C)

18S

18sF

CGGGGAGGTAGTGACGAAA

196 bp

62

 

18sR

CCGCTCCCAAGATCCAACTA

  

ACTB

ACTB f

ACGGGCAGGTCATCACCATC

166 bp

64

 

ACTB r

AGCACCGTGTTGGCGTAGAG

  

PPIA

PPIA Fq

TCCGGGATTTATGTGCCAGGG

206 bp

66

 

PPIA Rq

GCTTGCCATCCAACCACTCAG

  

TLR1

TLR1 Fq

ACCCTACTCTGAACCTCAAG

142 bp

62

 

TLR1 Rq

GACTGCACACTGGATTTCTG

  

TLR2

TLR2 Fq

ACTGGGTGGAGAACCTCATGGTCC

307 bp

62

 

TLR2 Rq

ATCTTCCGCAGCTTACAGAAGC

  

TLR4

TLR4 F2q

GCATGGAGCTGAATCTCTAC

238 bp

62

 

TLR4 R2q

CAGGCTAAACTCTGGATAGG

  

TLR5

TLR5 Fq

TTCCTGCAACCTCACCCAAG

192 bp

62

 

TLR5 Rq

CTGAGATTGGGCAGGTTTCG

  

TLR6

TLR6 Fq

CTCCGGGAGATAGTCACTTC

297 bp

62

 

TLR6 Rq

GGCCCTGGATTCTATTATGG

  

NOD1

NOD1 F2q

TGGTCACTCACATCCGAAAC

218 bp

62

 

NOD1 F2q

AGGCCTGAGATCCACATAAG

  

NOD2

NOD2-f

CCCAGGGGCTCAGAACTAACA

238 bp

62

 

NOD2-r

CCTTCATCCTGGACGTGGTTC