Skip to main content

Table 1 List of primers used in this study

From: Repertoire of Escherichia coli agonists sensed by innate immunity receptors of the bovine udder and mammary epithelial cells

Gene Primer ID Primer sequence Size of amplicon Annealing temperature (°C)
18S 18sF CGGGGAGGTAGTGACGAAA 196 bp 62
  18sR CCGCTCCCAAGATCCAACTA   
ACTB ACTB f ACGGGCAGGTCATCACCATC 166 bp 64
  ACTB r AGCACCGTGTTGGCGTAGAG   
PPIA PPIA Fq TCCGGGATTTATGTGCCAGGG 206 bp 66
  PPIA Rq GCTTGCCATCCAACCACTCAG   
TLR1 TLR1 Fq ACCCTACTCTGAACCTCAAG 142 bp 62
  TLR1 Rq GACTGCACACTGGATTTCTG   
TLR2 TLR2 Fq ACTGGGTGGAGAACCTCATGGTCC 307 bp 62
  TLR2 Rq ATCTTCCGCAGCTTACAGAAGC   
TLR4 TLR4 F2q GCATGGAGCTGAATCTCTAC 238 bp 62
  TLR4 R2q CAGGCTAAACTCTGGATAGG   
TLR5 TLR5 Fq TTCCTGCAACCTCACCCAAG 192 bp 62
  TLR5 Rq CTGAGATTGGGCAGGTTTCG   
TLR6 TLR6 Fq CTCCGGGAGATAGTCACTTC 297 bp 62
  TLR6 Rq GGCCCTGGATTCTATTATGG   
NOD1 NOD1 F2q TGGTCACTCACATCCGAAAC 218 bp 62
  NOD1 F2q AGGCCTGAGATCCACATAAG   
NOD2 NOD2-f CCCAGGGGCTCAGAACTAACA 238 bp 62
  NOD2-r CCTTCATCCTGGACGTGGTTC