Skip to main content

Table 1 Cytokine primer.

From: Induction of inflammatory cytokines and toll-like receptors in chickens infected with avian H9N2 influenza virus

Cytokine Forward Primer Reverse Primer
TGF-b3 1251F-GGTGGTGAAATCCTGCAAGT 1642R-CCCATTTCCAATCCCTCTTT
TNF-α 57F-CTTCTGAGGCATTTGGAAGC 407R-ACTGGGCGGTCATAGAACAG
INF-α 208F-GACATGGCTCCCACACTACC 556R-AGGCGCTGTAATCGTTGTCT
INF-β 421F-GCTCACCTCAGCATCAACAA 607R-GGGTGTTGAGACGTTTGGAT
INF-γ 320F- TGAGCCAGATTGTTTCGATG 471R-CTTGGCCAGGTCCATGATA
IL-1β 134F-GGATTCTGAGCACACCACAGT 405R-TCTGGTTGATGTCGAAGATGTC
IL-2 83F-TTGGCTGTATTTCGGTAG CA 251R-GTGCACTCCTGGGTCTCAGT
IL-4 99F-GGAGAGCATCCGGATAGTGA 284R-TGACGCATGTTGAGGAAGAG
IL-6 545F-ATCCGGCAGATGGTGATAAA 707R-CCCTCACGGTCTTCTCCATA
IL-8 459F-CATCATGAAGCATTCCATCT 663R-CTTCCA AGGGATCTTCATTT
IL-10 249F-GCTGCGCTTCTACACAGATG 451R-TCCCGTTCTCATCCATCTTC
GAPDH 343F-GACGTGCAGCAGGAACACTA 370R-TCTCCATGGTGGTGA AGACA