Skip to main content

Table 1 Oligonucleotide sequences used in the PCRs performed in this study and amplicon length.

From: Identification of the ovine mannose receptor and its possible role in Visna/Maedi virus infection

PCR Oligonucleotides 5'- 3' Amplicon length
MR0 MR0Fw
CCATGAGGCTACCCCTGCTCCTGGTT
MR1Rv
GCGTACCACTTGTTTTCAAACTTG
560 nt
MR1 MR1Fw
CCGAATCTCAGATTATGAGTGTTGC
MR2Rv
CTTGCAGATGTAGCCAAGAGGCC
1253 nt
MR2 MR6Fw
GGCAAAGATGGATACTGGGCAG
CDR5Rv
CATTTGCAAAATTGGGTTCACC
1279 nt
MR3 CDR4Fw
GGCGAACCTAATAATTATCAG
MR7Rv
GTGCATCCAGGCAAAAGCATTAC
1210 nt
MR4 MR10Fw
ACAGGTGATCCCTCTGGTGAAAGA
MR10Rv
CTAGATGRCCRCATGTTCRTTCTG
408 nt
qMR
(CDR4-CDR5)
MR Fw
TGGCAAATCCAGTTGTTAAGATGTT
MR Rv
AGAATGTTGAATACTGTGGCGAGTT
91 nt
β-actin (control) Actin 663 Fw
CTCACGGAGCGTGGCTACA
Actin 769 Rv
GCCATCTCCTGCTCGAAGTC
106 nt
qPCR (p17 EV1) MVV0262Fw
CTCCTTGCAGGCCACAATG
MVV0333Rv
GCTGCTTGCACTGTCTCGG
MVV0284P
6-FAM-TGCCTTATGTGTAGTCAGC-TAMRA
71 nt