Skip to main content

Table 1 List of primers used for the RT PCR quantification of gene expression

From: SPI-1-encoded type III secretion system of Salmonella enterica is required for the suppression of porcine alveolar macrophage cytokine expression

  Sequence 5'-3' Reference
IL1βFor GGGACTTGAAGAGAGAAGTGG this study
IL1βRev CTTTCCCTTGATCCCTAAGGT this study
IL8For TTCTGCAGCTCTCTGTGAGGC [14]
IL8Rev GGTGGAAAGGTGTGGAATGC [14]
TNFβFor CCCCCAGAAGGAAGAGTTTC [13]
TNFβRev CGGGCTTATCTGAGGTTTGA [13]
IL23p19αFor GACAACAGTCAGTCCTGCTTGC this study
IL23p19αRev ACAGAGCCATCAGGGTGTAGAGA this study
IL12p40βFor CACTCCTGCTGCTTCACAAA this study
IL12p40βRev CGTCCGGAGTAATTCTTTGC this study
IL12p35αFor AACTAGCCACGAATGAGAGTTGC this study
IL12p35αRev GCACAGGGTTGTCATAAAAGAGG this study
TGFβFor TACGCCAAGGAGGTCACCC this study
TGFβRev CAGCTCTGCCCGAGAGAGC this study
IL18For ATGCCTGATTCTGACTGTTC this study
IL18Rev CTGCACAGAGATGGTTACTGC this study
GMCSFFor TCTGTTGGCCAAGCACTATG this study
GMCSFRev GCAGTCAAAGGGGATGGTAA this study
IL6For CACCGGTCTTGTGGAGTTTC this study
IL6Rev GTGGTGGCTTTGTCTGGATT this study
NRAMPFor ATCAACCTCTTTGTCATGGCTGT this study
NRAMPRev AGATCTTGGCGTAGTCGTGGAG this study
SOD1For CATTAAAGGACTGGCTGAAGGTG this study
SOD1Rev CTGCACTGGTACAGCCTTGTG this study
phox 47For GACCATCGAGGTCATTCATAAGC this study
phox 47Rev ACATGGATGGGAAGTAACCTGTG this study
iNOSFor GTGATGGCCGACCTGATGTT [12]
iNOSRev GGCCCAGGAAATGTTCGAG [12]
HPRTFor GAGCTACTGTAATGACCAGTCAACG [13]
HPRTRev CCAGTGTCAATTATATCTTCAACAATCAA [13]