Skip to main content
  • Research article
  • Open access
  • Published:

Variation in the prion protein gene (PRNP) open reading frame sequence in French cervids

Abstract

The recent emergence of chronic wasting disease (CWD) in Europe has become a new public health risk for monitoring of wild and farmed cervids. This disease, due to prions, has proliferated in North America in a contagious manner. In several mammalian species, polymorphisms in the prion protein gene (PRNP) play a crucial role in the susceptibility to prions and their spread. To obtain a reliable picture of the distribution of PRNP polymorphisms in the two most common cervid species in France, we sequenced the open reading frame (ORF) of this gene in 2114 animals, 1116 roe deer (Capreolus capreolus) and 998 red deer (Cervus elaphus). Selection criteria such as historical origin, spatial distribution and sex ratio have been integrated to establish this sample collection. Except for one heterozygous animal with a non-synonymous mutation at codon 37 (G37A), all the 1116 French roe deer were monomorphic. Red deer showed greater variation with two non-synonymous substitutions (T98A; Q226E), three synonymous substitutions (codons 21, 78 and 136) and a new 24pb deletion (Δ69-77). We found significant regional variations between French regions in the frequency of the identified substitutions. After cloning of the PRNP ORF from animals presenting multiple non-synonymous polymorphisms, we identified six haplotypes and obtained a total of twelve genotypes. As in other European countries, we highlighted the apparent homogeneity of PRNP in the French roe deer and the existence of a greater diversity in the red deer. These results were in line with European phylogeographic studies on these two species.

Introduction

Chronic wasting disease (CWD) is a fatal transmissible spongiform encephalopathy (TSE) that affects captive and wild Cervidae. CWD has the widest potential species range among prion diseases and is the only one of greatest concern affecting wildlife populations. As such, it is recognised as a major emerging threat to wildlife. As for other TSE, CWD is caused by misfolding of the cellular prion protein (PrPC) to a pathogenic conformer (PrPSc). CWD prions are often lymphotropic, at least in North American cervid species, and infected cervids likely shed prions replicated in lymphoid organs. Thus, CWD is mainly transmitted horizontally, through either direct contact or prion-contaminated environmental sources (e.g. remains of infectious carcasses, body fluids, feed, water, soil, fomites). Infection of naïve deer introduced to highly contaminated pens indicates that infectivity is retained for at least five years [1]. The species host range and thus zoonotic risks associated with CWD remains to be clearly established [2,3,4,5,6,7]. At the same time, it has been estimated that up to 15 000 CWD-infected cervids are consumed by people each year in the United States [2].

The disease’s range extends across North America and Northern Europe. It was first described in a mule deer (Odocoileus hemionus) at a research centre in Colorado in 1967 and in wild deer in 1981 but recent studies have suggested that CWD had already been present for ten to 20 years prior to its initial identification [8]. The disease is now geographically widespread in North America, being detected in 34 US states and five Canadian provinces in free-ranging cervids and/or commercial captive cervid facilities (United States Geological survey, National Wildlife Health Center, Updated June 2024). In heavily affected areas of Wyoming, Colorado and Wisconsin, more than 40% of free-ranging cervids are infected and population declines associated with CWD in white-tailed deer (Odocoileus virginianus), mule deer and elk (Cervus elaphus nelsoni) are documented [9,10,11].

In Europe, the first cases of infected wild reindeer (Rangifer tarandus tarandus) were detected in the mountainous region of Nordfjella in Norway in 2016 leading to the eradication of the entire population of around 2000 reindeer in the area [12]. Since then and up to December 2023, a total of 43 CWD cases were confirmed in Norway, Sweden and Finland, including moose (Alces alces), reindeer as well as red deer (Cervus elaphus) [8, 13]. In Sweden and Finland, four and three affected moose were identified, respectively. In Norway, twelve infected moose, 21 reindeer and three red deer were observed. Where cases were detected the prevalence was below 1% [8]. The affected reindeer in Norway were geographically clustered, with 19 cases coming from Nordfjella management zone one. The other two cases were detected in 2020 and 2022 in the Hardangervidda area. In comparison, cases reported in moose and red deer were more geographically scattered [14].

Two main pathological phenotypes can be distinguished in European cervids: the Ly + phenotype characterized by the presence of detectable PrPSc accumulations in lymphoid tissues, with or without deposits in brain tissue, and the Ly- or sCWD (sporadic CWD) phenotype, with detectable PrPSc accumulation in the Central Nervous System (CNS), but not in lymphoid tissues [8, 14]. Until now, the Ly + phenotype has been observed in wild reindeer, resembling the patterns described in CWD of North American cervid species. Abundant lymphoreticular involvement reflects the dissemination of prions in the body and natural shedding, which could be associated with a greater probability of natural transmission between live animals [8]. The Ly- or sCWD phenotype has only been observed in old aged moose and red deer. So far, five physio-pathological and biochemical distinct types of cervid TSE, potentially representing different strains, have been identified out of eight European isolates (three reindeer, four moose, one red deer). These putative strains would differ from the North American ones [15,16,17,18,19].

Effective measures to prevent transmission of the disease in cervids are limited. In North America, depopulation of infected farms, double fencing and restrictions on the transport of farmed cervids have not been effective to date [20]. Polymorphisms in the gene encoding the prion protein (PRNP) influence susceptibility or resistance to the progression of prion diseases in humans and animals. For example, the selection of PRNP alleles associated with resistance to classical scrapie successfully helped controlling TSEs in small ruminant species in several European countries. In North America, the PRNP sequence of a dense sampling (i.e. more than 1400 samples) on white-tailed deer showed some protective influence of 95H, 96S, 116G and 226 K [21,22,23] and 225F for mule deer [24]. For example, in order to reduce the risk of infection, a selective breeding program for farmed white-tailed deer in high-prevalence CWD endemic area, focusing on the elimination of the 96G variant has recently been developed [25]. Increased knowledge of PRNP variability in the main European cervid species will make it possible to map frequencies of known PRNP alleles and, in the best-case scenario, will allow identification of new alleles that can serve as leverage to combat the spread of CWD. In France, the roe deer (Capreolus capreolus) and the red deer are the two most common cervid species. Currently, for these two species, each year the French Biodiversity Agency (OFB) in partnership with the Fédération Nationale des chasseurs (national hunters’ federation) and Fédérations départementales des chasseurs (departmental hunters’ federations), monitors the hunting tables to estimate the distribution of all wild ungulates present on French territory. These data are based on a system of systematic national surveys centralised and analysed, and serve as a national benchmark. On a national scale, there is no reliable method for correctly estimating the density and/or abundance of free-ranging animals living in the wild in an open area. Depending on the circumstances and the species under consideration, certain methods are preferred to obtain indices and trends on the distribution of animals. However, over long-time scales, knowledge gained from hunting data allows us to assess trends in the abundance and distribution of these animals. For example, in 42 years, hunting quotas have increased by a factor of 8.7 for roe deer and 8.3 for red deer. Roe deer are present in 93 of the 96 departments (all 13 regions) of mainland France, occupying 92% of the territory with one point five to four million individuals. In 2020, red deer were present in 87 departments, occupying an area of 218 177 km2, covering almost 40% of the national territory. In 2023, the population was estimated to be in the 150 000 and 400 000 range [26, 27].

The aim of this study was to obtain a reliable picture of the distribution of PRNP polymorphisms among red deer and roe deer populations in France. This genetic information will be crucial in estimating the potential susceptibility of these populations to the emergence of CWD.

Materials and methods

Animal sampling

For the purpose of this study, a total of 2143 samples belonging to 1134 roe deer and 1009 red deer were collected. This collection of French cervids was obtained thanks to two complementary sampling campaigns referenced as the OFB (French Biodiversity Agency) collection and the INRAE-CEFS (Wildlife Behaviour and Ecology) laboratory collection. In order to obtain a relatively representative sample collection, we tried not to take more than two samples per day from the same hunting area.

OFB collection

A national sampling of red deer and roe deer populations was carried out during the 2020–2021 and 2021–2022 hunting seasons by the OFB. The sampling plan was forwarded to the departmental hunting federations, which supervised the local hunting societies. In addition, four OFB study areas took part in the sampling. A total of 614 samples of roe deer and 687 samples of red deer were provided. All tissue samples in this collection were sent in a 70% ethanol solution.

INRAE-CEFS collection

For the regions of France partially or not covered by the OFB programme, additional DNA samples from 520 roe deer and 322 red deer were provided by the INRAE-CEFS laboratory. These were samples collected on live animal as part of a long-term population monitoring programme, or samples collected with the collaboration of national hunting federation and the ELIZ institution (an interdepartmental institution focussed on zoonosis control).

Overall, samples from the French cervid collection mainly came from hunting (1010 roe deer, 971 red deer). Other samples came from live biopsies (109 roe deer, 38 red deer) or road-kill or slaughtered animals (15 roe deer). Roe deer samples consisted of small sections of muscles (581), spleen (399), skin (118), cartilage (32) and liver (one) and three unspecified. Most were collected between 2020 and 2022 (920) and some (214) between 2004 and 2019. Red deer samples consisted of small sections of muscle (661), skin (229), spleen (93) and cheek (26). Most were collected between 2020 and 2022 (865) and some (144) between 2004 and 2019. For each sample, further information including sex, age class (juvenile, yearling, adult) and coordinates of the municipality of hunting, was collected. The distribution of sampling sites for each species is shown in Figure 1.

Figure 1
figure 1

Geographical distribution of sampling sites in the French regions obtained by the OFB and INRAE-CEFS sampling campaigns. Each point represents one animal, roe deer (blue circle), red deer (brown triangle).

To enable a secure sample management and distribution, all the red deer samples (1009) and 75% of the roe deer samples (850) are stored since spring 2024 under the project name CerviFrance at the @BRIDGe Biological Resource Center of the CRB-Anim infrastructure [28].

Extraction and purification of genomic DNA

A small section of tissue (< 10 mg) was added to 1 mL of lysis buffer (Tris 100 mM pH 7.4, EDTA 5 mM, SDS 0.2%, NaCl 0.2 M) and digested with 12 µL of Proteinase K (20 mg/mL) by incubation for 3 h at 55 °C. After centrifugation for 10 min at 15 000 g, the supernatant was transferred to a new tube and precipitated with 1 mL of isopropanol following a standard precipitation protocol [29]. The DNA was dissolved in 50 or 100 µL of Tris 10 mM pH 7.4 EDTA 0.1 mM buffer at 65 °C during 45 min and stored at −20 °C until use.

For samples (64) not yielding sufficient DNA quality using the above method, an alternative DNA extraction method using Puregene core kit A (158667, Qiagen, Oslo, Norway) was used according to manufacturer’s instructions. The 842 samples from the INRAE-CEFS collection were extracted using the Macherey–Nagel Nucleospin Tissue kit (Cat. # 740952.250) as per manufacturer’s instructions.

PRNP gene amplification and sequencing

The open reading frame (ORF) of cervid PRNP (771 bp) was amplified using Go Taq G2 flexi-PROMEGA polymerase and buffers, in a 50 µL of reaction volume containing 100 µM of each dNTP (Promega), 3 mM of MgCl2, 10 µmol of each oligonucleotide primer (Eurofins Genomics, Ebersberg, Germany), 1.5 U of Taq polymerase and 100 to 150 ng of genomic DNA. The PCR forward primer was ACA CCC TCT TTA TTT TGC AG (Ce-08-F) and the reverse primer was AGA AGA TAA TGA AAA CAG GAA G (Ce-778-R). PCR conditions were at 94 °C for 5 min, followed by 40 cycles of 94 °C for 30 s, 58 °C 30 s and 72 °C for 1 min, and a final extension at 72 °C for 3 min.

PCR products (830 pb) were visualized electrophoretically on a 1.5% agarose gel before being sent for a double strand sequencing with Primers Ce-08-F and Ce-778-R to Eurofins Genomics (Ebersberg, Germany). Chromatographs were checked and analysed using CodonCode Aligner [30].

Cloning

PRNP coding sequences were amplified as described in the PRNP gene amplification and sequencing section, but with a final extension at 72 °C for 7 min. The amplicons were purified using PURELINK Quick PCR purification Kit (K31001, Invitrogen, Vilnius, Lithuania) according to manufacturer’s instructions. Purified products were then cloned using TOPO TA cloning Kit (K450040, Invitrogen, Vilnius, Lithuania) following the procedure provided by the manufacturer. For each cloned sample, two to four clones were selected and sent to Eurofins Genomics (Ebersberg, Germany) for both strand sequencing with primers Ce-08-F and Ce-778-R. Chromatographs were checked and analysed using CodonCode Aligner [30].

Species verification

To control the correct assignment of the species indicated in our database with each DNA sequenced, we checked all the positions which were different between roe deer and red deer sequences, namely positions 63 (codon 21 g\c), 221 (codon 74 a\t), 384 (codon 128, t\c), 408 (codon 136, c\t), 438 (codon 146, c\t), 618 (codon 206, t\c) and 741 (codon 247, a\c).

Maps and statistical analysis

The map with the geographical distribution of roe deer and red deer genotyped samples (Figure 1) was generated using QGIS [31].

The linkage disequilibrium (LD) between pairs of positions was measured by the so-called r2 coefficient [32]. This measure is simply the square of the conventional correlation of gene frequencies in the sample (Table 5).

Independence between pairs of positions was tested with the Fisher’s exact test (Table 5) [33].

Residual-based shading plots, or mosaic plots were used to visualize contingency tables [34]. In these plots, the area of the cell represents the counts, the cell’s width represents the marginal probability within the row, while the cell’s height represents the marginal probability within the column. Under the null hypothesis of independence, all the cells are grey. The colour code in the legend represents the standardized Pearson’s residuals from independence and shows whether the number of observed individuals is greater (blue) or smaller (red) than that theoretically expected.

Statistical analyses (Tables 2, 3, 4) and plots were realized with the R package (R Core Team, 2003). Mosaic plots were realized with the vcd package (Figures 2 and 4) [35]. The Map corresponding to Δ69-77 allelic frequencies was done with the geodata [36] and terra [37] packages (Figure 3).

Figure 2
figure 2

Mosaic diagram showing the contingency tables for each SNP-region combination. The area of the cell (rectangle) represents the quantities (numbers), the width of the cell represents the marginal probability in the row (region), the height of the cell represents the marginal probability in the column (number of animals per SNP within a region) and the colour of the cell represents the Pearson standardised residual with respect to independence (blue numbers higher than expected and red numbers lower than expected). The graphs were coloured on the basis of the Pearson residuals.

Figure 3
figure 3

Geographical localisation ∆69-77 allelic frequencies obtained in red deer in France. The map has been coloured according to the frequencies. NA: Not Applicable.

Accession numbers

Seven sequences were deposited in GenBank with the following accession numbers: PP512526 (red deer with A98 haplotype), PP512527 (red deer with A98E226 haplotype), PP512529 (red deer with Δ69-77A98 haplotype), PP512532 (red deer with E226 haplotype and synonymous mutation at codon 136), PP512533 (red deer with haplotype E226 haplotype and synonymous mutations at codons 21 and 136), PP512535 (wildtype red deer) and PP512539 (roe deer A37 haplotype).

Results

Sampling

After extraction of genomic DNA, amplification, sequencing and analysis of the cervid PRNP ORF, we obtained sufficient readable sequences for 1116 roe deer out of the 1134 animals collected and 998 red deer out of the 1009 animals collected (i.e. an efficiency of 98%). The geographical location of these animals is shown in Figure 1. The number of samples per species and per region is shown in Table 1. 53% and 45% of the samples were females for red deer and roe deer, respectively. This collection met with a certain number of criteria such as historical origin, spatial distribution, sex ratio and geographical distance between animals.

Table 1 Distribution by region and sex of roe deer and red deer sequenced for PRNP in the present study

Identified non-synonymous polymorphisms were reported as variations from a consensus or wild type sequence (wt, roe deer and red deer T98P168Q226). We followed the EFSA (2023) suggestions on naming alleles by codon position and a one letter amino acid abbreviation for all positions that deviate from wt.

Roe deer

All analysed French roe deer (n = 1116) were homozygous wt at the PRNP locus, except one heterozygous animal with a non-synonymous mutation at codon 37 (g/c position 110) resulting in a glycine to alanine amino acid change (G37A). The presence of this substitution was confirmed by three independent PCR amplifications of the ORF and subsequent sequencing in both strands. The amino acid sequence of all other animals showed 100% identity with the cervid consensus sequence. Except for one animal, this gene appears to be fixed.

Red deer

In red deer samples (n = 998), we detected polymorphisms at five nucleotide positions (SNPs) and one novel deletion of 24 bp. Three synonymous substitutions were identified at codon 21 (c/t, nucleotide position 63), 78 (g/a nucleotide position 234) and 136 (t/c nucleotide position 408). The substitution at codon 78 was only present in three individuals among the 998 studied. The substitutions at codon 21 and 136 were present at frequencies of 2% and 45%, respectively (Table 2). Two non-synonymous substitutions were observed at codon 98 (a/g nucleotide position 292) and 226 (c/g, nucleotide position 676), giving rise to threonine to alanine (T98A) and glutamine to glutamic acid (Q226E) amino acid changes, respectively. At codon 98, the wt allele was the most common with a frequency of 68%, whereas at codon 226, the two alleles had more balanced frequencies (45% for Q, 55% for E). A new 24 bp deletion was identified within the octa-peptide repeat region with a frequency of 3%. This ccaacctcatggaggtggctgggg deletion corresponds to the deletion of codons 69 to 77, QPHGGGWG (Δ69-77, position 207 to 230). Except for the deletion Δ69-77, observed polymorphisms have been previously documented in European red deer.

Table 2 Allele frequencies of the PRNP polymorphisms in red deer from France (n = 998)

We found significative variations between French regions in the frequency of the substitutions identified (Figure 2, Table 3). The frequency of the A98 allele was significantly lower in the Centre Val-de-Loire region (15%) and in the Grand-Est (22%), whereas it was higher than expected in Occitanie (48%). Furthermore, five regions-Bretagne, Centre Val-de-Loire, Corse, Grand-Est and Occitanie-differed significantly in terms of frequencies of alleles at positions 136 and 226. The E226 allele was significantly more frequent in the Centre Val-de-Loire and Corse regions, with frequencies of 80% and 74%, respectively, whereas it was below the expected value in the Grand-Est and Occitanie regions (42% and 46%, respectively). The Δ69-77 deletion was detected in the regions of Normandie, Hauts-de-France, Grand-Est, Bourgogne-France-Comté and Nouvelle Aquitaine (Figure 3). This deletion was mainly found in regions bordering Germany, Belgium and Luxembourg, with frequencies of 9% and 14% for the Grand-Est and Hauts-de-France regions, respectively.

Table 3 Percentage of allele frequencies of PRNP polymorphisms in French red deer in 10 regions of France ( n = 998)

Haplotype and genotype frequencies in red deer

Of the 998 red deer sequenced, 315 had multiple polymorphisms at non-synonymous substitutions (Δ69-77, codons 98 or 226). To determine the haplotype of these animals, their amplified ORFs were cloned and sequenced and three of them were excluded due to inconclusive sequence results. Haplotype frequencies were therefore calculated on a total of 995 animals (Table 4). Among the eight possible haplotypes we have detected six haplotypes namely wt (T98Q226), E226, A98, A98E226, Δ69-77A98 and Δ69-77E226. The deletion carried by 55 animals appeared, with the exception of one animal, associated with A98.

Table 4 Haplotype frequencies of PRNP non-synonymous polymorphisms and Δ69-77 deletion in French red deer populations (n = 995)

Haplotype frequencies revealed that the most prevalent haplotype was E226 with a frequency of 55.2% while the wt haplotype was present at a frequency of 12.75% (Table 4). The two newly identified novel haplotypes carrying the deletion were relatively rare (3% for Δ69-77 A98 and 0.05% for Δ69-77 E226).

Pairwise analysis of linkage disequilibrium (LD) between positions 63, 292, 408, 676 and Δ69-77 (codons 21, 98, 136, 226 and Δ69-77) indicated that these positions were almost all genetically linked (Table 5). However, at positions 63 (codon 21) no genetic association was found with the position 292 (codon 98) neither with the deletion (r2 = 0 and P-value = 0.025 and 0.61 respectively, Table 5). These analyses involved only 889 samples as 106 animals with multiple polymorphisms at synonymous substitutions were not cloned.

Table 5 Linkage disequilibrium (LD) between position pairs of PRNP variant and dependence between PRNP position pairs

We obtained a total of twelve genotypes. Four were rare, having a frequency of less than 1%. The most frequent genotypes were E226\E226 and A98\E226 respectively (Table 6). Overall, similar frequencies were observed between heterozygous (48%) and homozygous (52%) animals in the French population, although the deletion was more frequent at heterozygous state (89%).

Table 6 Genotype frequencies of PRNP polymorphisms in French red deer populations (n = 995)

We performed a mosaic plot based on genotypes obtained from 995 animals to provide a regional scale characterization of their frequencies (Figure 4). The number of genotypes observed per region varied from four in the Corse region to eleven in the Hauts-de-France region. Although each region had its own particularities, it can be seen that the Grand-Est region differed the most, with eight genotypes having a frequency significantly different from those observed on average in France. In this region, genotypes wt\wt, wt\E226, wt\A98, wt\Δ69-77-A98 and E226\Δ69-77-A98 were significantly more frequent than expected while E226\ E226, A98\A98 and A98\E226 were significantly less. The difference observed in the Hauts-de-France region was mainly due to the genotype associated with the deletion.

Figure 4
figure 4

Mosaic diagram showing the contingency tables for each Genotype-region combination. The area of the cell (rectangle) represents the quantities (numbers), the width of the cell represents the marginal probability in the row (region), the height of the cell represents the marginal probability in the column (number of genotypes in a region) and the colour of the cell represents the Pearson standardised residual with respect to independence (blue numbers higher than expected and red numbers lower than expected). The graphs were coloured on the basis of the Pearson residuals.

Discussion

This study is the first investigating the diversity of the PRNP gene ORF in the two most common cervid species in France. A total of 2114 animals were studied, 1116 roe deer and 998 red deer. The nature of this sampling makes it as representative as possible of these two species in France. As such, this collection will be preserved for future genetic studies by the @BRIDGe Biological Resource Center of the CRB-Anim infrastructure. This study represents the largest survey of PRNP genetic variation in roe deer and red deer population of any European country to date.

Except for one animal, all the 1116 French roe deer were monomorphic in PRNP sequence, with 100% amino acid sequence identity with the cervid wt PrP. Similar observations were reported in roe deer from Great Britain (N = 297), Alpine arc of Italy (N = 189), Northeast of Spain (N = 44), Sweden (N = 11) or Norway (N = 46) [38,39,40,41]. These results are consistent with the history of colonization of Europe by roe deer. The European roe deer is one of the most common ungulates in Europe. It is distributed from the Mediterranean zone to Scandinavia and the eastern border of its range reaches western Russia [42, 43]. This species experienced dramatic fluctuations due to climatic factors and anthropogenic influences. It was forced into refugia to the Mediterranean peninsulas with the exception of south-western France and the surroundings of the Carpathian during the Last Glacial Maximum (LGM, 21.0–14) [44]. During postglacial periods the species distribution extended further north and on western, central and northern Europe around 9600 years ago. More recently between the 17th and early twentieth century, extensive deforestation, poaching and excessive hunting caused a dramatic decline of the species throughout Europe with even local eradication in central and south Iberia, in western Italian alps and Apennines and in Greece [45]. After the Second World War, for example, concerted management structures or conservative harvesting rules were set up at national levels and helped to increase the number of individuals of this species.

Recently a phylogeographic study based on the analysis of 3010 control mitochondrial DNA sequences from European roe deer have showed a strong geographical pattern with a clear division into three major clades: Eastern, Western and Central. This latest clade covered large parts of the continent. In addition, these data suggested that the refugial population of southern France might have spread to cover the whole western and north-western Europe, possibly reaching the central and eastern parts of the continent [43].

In our study, red deer showed greater PRNP sequence variation with two non-synonymous substitutions (T98A; Q226E), three synonymous substitutions (codons 21, 78 and 136) and one novel deletion of 24pb (Δ69-77). These substitutions have been previously documented in European red deer and the deletion Δ69-77 has also been recently detected in Germany [46]. After cloning PRNP sequences from animals presenting multiple non-synonymous polymorphisms, we found a significant linkage between SNPs resulting in substitutions at positions 98, 136, 226 and the deletion. We identified six haplotypes, three of which are more frequent and correspond to those found mainly in Europe. However, it should be noted that the number of European red deer studied in different countries at the level of PRNP is uneven and represents a different power of resolution. Overall, less than 1200 animals have been previously surveyed: 627 in Great Britain, 209 in north-eastern Spain, 191 in Italy, 106 in 40 Norwegian municipalities and 55 in central-eastern Portugal [38, 40, 41, 47,48,49]. In the present study, the wt haplotype was relatively rare as reported in Norway (11%), whereas it was observed across Europe at frequencies ranging from almost 30% (England, Scotland) to 71% (Portugal). Haplotype E226 had a frequency similar to that observed in Scotland (50%), whereas it was found to be very common in England and Norway and only moderately in the other European countries analysed. Haplotype A98 (28.9%) was present at similar frequencies to those of Spain and Czechoslovakia, whereas it was not detected in England.

Although based only on a single gene, these results were consistent with broad European red deer phylogeographic studies which classified extant European red deer into five mitochondrial lineages. Among these lineages, the western haplogroup (designated A) was distributed along a south-north axis from Iberia through France and the British Isles, to Scandinavia and Central Europe [50,51,52,53]. An eastern haplogroup (designated C) was found in the Balkans and parts of Eastern and Central Europe. These are the two major lineages. They co-occur in, for example, Czechoslovakia, Austria and Poland [53, 54].

In France, red deer was historically abundant until the early 18th century, then declined sharply with the democratisation of hunting rights during the French Revolution and poaching, which was accelerated by the proliferation of weapons during and after the wars of 1914–1918 and 1939–1945, and the need of food during the wars. After this period, the red deer slowly recovered, thanks to protection laws, hunting reserves and restocking. It has been estimated that around a third of all populations were artificially established between the 1950s and 1970s with the release of red deer mainly from the Domaine National de Chambord enclosure and with animals from the Petite-Pierre National hunting and wildlife Reserve. In 2000, it was estimated that the proportion of red deer resulting from these artificial reintroductions reached 50% of the national population [55]. This repopulation was also accompanied by concerted management structures, conservative harvesting rules (generalisation of hunting plans in 1979), the abandonment of agricultural land to fallow but also the increase of forest areas and the extinction of natural predators. However, this expansion has been highly variable, fluctuating in response to the local hunting laws or forestry demands [55,56,57]. A parallel could be drawn between the origin of the deer populations present in France and the distribution pattern of PRNP haplotypes. For example, the most frequent haplotype in France, E226, corresponded to the genotype in excess in the Centre-Val-de-Loire region, of which the Domaine of Chambord is a part. In addition, Corse red deer, which are currently protected, showed a frequency of the A98\E226 genotype that was significantly different from that expected in France, and this region and Bretagne both showed least PRNP diversity. These results were consistent with previous studies based on microsatellite data, where a reduced level of genetic variability had been observed in red deer from four forests in Bretagne [57]. It is plausible to explain this low genetic variability by a combination of geographic isolation and a small population size in the recent past. In fact, the original Corse red deer population disappeared at the end of the 1960s due to a major opening up of its habitat, uncontrolled hunting and intensive poaching. This population was then re-established through releases of 300 Sardinian animals considered to be of the same origin, but the effective population size in Sardinia populations has been estimated at 8, which is particularly low [26, 50, 58].

Finally, the region with the greatest number of different PRNP genotypes was the region of Grand-Est which includes the Petite-Pierre reserve. Additionally, a recent study based on mitochondrial DNA highlighted that in north-eastern France red deer populations were built from a few hundred individuals that have subsisted in remote valleys of the Vosges mountains [56]. This particular history might explain the detection of the rare Δ69-77 allele that is also found in Germany [46].

Our study has provided an analysis of sequence variation in the PRNP ORF in the two most common cervid species in France, the roe deer and the red deer. As in other parts of Europe, we found genetic homogeneity in the French roe deer and greater diversity with regional differences in the red deer. To date, a total of 35 polymorphic codons have been reported in the PRNP ORF in cervid species, with the greatest number of polymorphisms observed in white-tailed deer, sika deer (Cervus nippon) and reindeer. For example, in a recent study of 221 wild Norwegian reindeer, the 225Y allele was associated with reduced susceptibility to CWD compared with the wt and del84-91 alleles, with wt/wt animals showing the highest susceptibility [38]. Thus, overall, the protective influence of the different alleles has been highlighted, but so far it appears that all PRNP genotypes reported in cervids are affected by CWD [59, 60]. One of the original findings of our study is the identification of a new allele presenting the deletion of an octa-peptide repeat region (OR) in red deer. The physiological and pathological roles of this OR region on PrPc are still understudied. The prion gene family derived from a subset of the ZIP family of metal ion transporters [61]. PrPc is involved in different functions, which include among others critical roles in the maintenance of metal (copper, zinc, iron, manganese) homeostasis. Metals are essential for normal brain functions; their concentrations and chemical forms are strictly regulated and their dysregulation is linked to several neurodegenerative diseases [62]. Metals are known to crosslink proteins by binding to several amino acids such as histidine, arginine and phosphorylated amino acids. PrPc is more selective for Cu2+ compared to other metals due to the metal chelating effects of histidine [63]. PrPc possesses six histidine residues, including one in each of its OR. This OR region could act as a conformational switch and be involved in prion infection [64]. Disruption of the integrity of this region by the insertion or deletion of the OR sequence have been shown to affect the characteristic of resulting oligomers and fibrils as well as disease phenotypes, in different clinical, biophysical, in vitro or transgenic mouse studies [65]. For example, it has been shown that the number of ORs can be inversely associated with incubation times after BSE prion inoculation into transgenic mice expressing a bovine PrP [66,67,68]. Furthermore, using OR deficient PrPc mice, it has been recently suggested that the OR region might be involved in prion pathogenesis in a strain dependent manner [69, 70]. Thus, investigations of the properties of the newly identified PrPΔ69-77 using different panel of CWD isolates from Scandinavia and North America are worth undertaking and are indeed currently being initiated.

It remains that the first cases of cervids affected by CWD discovered in Scandinavia are a warning to other European countries which, on the basis of the genotypes observed to date, would appear to be rather susceptible to CWD. The appearance of TSE cases, particularly in geographical areas not currently sampled or tested, cannot be ruled out in European cervids and measures must be taken as soon as possible to avoid the spread of this disease in target populations, as it has unfortunately been observed in North America. There are many complex rules and procedures governing this wildlife disease, so future monitoring at a European-wide level will require multidisciplinary approaches.

Availability of data and materials

The @BRIDGe Biological Resource Center of the CRB-Anim infrastructure will manage and distribute the CerviFrance collection [28]. The datasets used and/ or analyzed during the current study are available from the corresponding author on reasonable request.

Abbreviations

CWD:

chronic wasting disease

PRNP:

prion protein gene

TSE:

transmissible spongiform encephalopathy

PrPC :

protease-sensitive cellular prion protein

PrPSc :

abnormal protease-resistant isoform of the prion protein

US:

United States

Ly:

lymphoid

sCWD:

sporadic chronic wasting disease

CNS:

central nervous system

TSEs:

transmissible spongiform encephalopathies

i.e.:

id est (That is)

OFB:

French Biodiversity Agency

CEFS:

Wildlife Behaviour and Ecology

INRAE:

National research institute for agriculture, food and the environment

ORF:

open reading frame

LD:

linkage disequilibrium

wt:

wild type

SNPs:

single nucleotides polymorphisms

PrP:

normal cellular prion protein

LGM:

last glacial maximum

OR:

octa-peptide repeat region

ZIP:

zinc-regulated transporters, iron-regulated transporter-like protein

References

  1. Miller MW, Williams ES (2004) Chronic wasting disease of cervids. Curr Top Microbiol Immunol 284:193–214. https://doi.org/10.1007/978-3-662-08441-0_8

    Article  CAS  PubMed  Google Scholar 

  2. Bartz JC, Benavente R, Caughey B, Christensen S, Herbst A, Hoover EA, Mathiason CK, McKenzie D, Morales R, Schwabenlander MD, Walsh DP, the NC1209: North American Interdisciplinary Chronic Wasting Disease Research Consortium Members (2024) Chronic wasting disease: state of the science. Pathogens 13:138. https://doi.org/10.3390/pathogens13020138

    Article  CAS  Google Scholar 

  3. Race B, Williams K, Orrú CD, Hughson AG, Lubke L, Chesebro B (2018) Lack of transmission of chronic wasting disease to cynomolgus macaques. J Virol 92:00550–00618. https://doi.org/10.1128/JVI.00550-18

    Article  Google Scholar 

  4. Race B, Williams K, Chesebro B (2019) Transmission studies of chronic wasting disease to transgenic mice overexpressing human prion protein using the RT-QuIC assay. Vet Res 50:6. https://doi.org/10.1186/s13567-019-0626-2

    Article  PubMed  PubMed Central  Google Scholar 

  5. Race B, Meade-White KD, Miller MW, Barbian KD, Rubenstein R, LaFauci G, Cervenakova L, Favara C, Gardner D, Long D, Parnell M, Striebel J, Priola SA, Ward A, Williams ES, Race R, Chesebro B (2009) Susceptibilities of nonhuman primates to chronic wasting disease. Emerg Infect Dis 15:1366–1376. https://doi.org/10.3201/eid1509.090253

    Article  PubMed  PubMed Central  Google Scholar 

  6. Marsh RF, Kincaid AE, Bessen RA, Bartz JC (2005) Interspecies transmission of chronic wasting disease prions to squirrel monkeys (Saimiri sciureus). J Virol 79:13794–13796. https://doi.org/10.1128/JVI.79.21.13794-13796.2005

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  7. Kurt TD, Jiang L, Fernández-Borges N, Bett C, Liu J, Yang T, Spraker TR, Castilla J, Eisenberg D, Kong Q, Sigurdson CJ (2015) Human prion protein sequence elements impede cross-species chronic wasting disease transmission. J Clin Invest 125:1485–1496. https://doi.org/10.1172/JCI79408

    Article  PubMed  PubMed Central  Google Scholar 

  8. EFSA Panel on Biological Hazards (BIOHAZ), Koutsoumanis K, Allende A, Alvarez-Ordoñez A, Bolton D, Bover-Cid S, Chemaly M, Davies R, De Cesare A, Herman L, Hilbert F, Lindqvist R, Nauta M, Peixe L, Skandamis P, Suffredini E, Miller MW, Mysterud A, Nöremark M, Simmons M, Tranulis MA, Vaccari G, Viljugrein H, Ortiz-Pelaez A, Ru G (2023) Monitoring of chronic wasting disease (CWD) (IV). EFSA J Eur Food Saf Auth 21:e07936. https://doi.org/10.2903/j.efsa.2023.7936

    Article  CAS  Google Scholar 

  9. Edmunds DR, Kauffman MJ, Schumaker BA, Lindzey FG, Cook WE, Kreeger TJ, Grogan RG, Cornish TE (2016) Chronic wasting disease drives population decline of white-tailed deer. PLoS One 11:e0161127. https://doi.org/10.1371/journal.pone.0161127

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  10. DeVivo MT, Edmunds DR, Kauffman MJ, Schumaker BA, Binfet J, Kreeger TJ, Richards BJ, Schätzl HM, Cornish TE (2017) Endemic chronic wasting disease causes mule deer population decline in Wyoming. PLoS One 12:e0186512. https://doi.org/10.1371/journal.pone.0186512

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  11. Cook JD, Cross PC, Tomaszewski EM, Cole EK, Grant EHC, Wilder JM, Runge MC (2023) Evaluating management alternatives for Wyoming elk feedgrounds in consideration of chronic wasting disease. U.S. Geological Survey. https://www.usgs.gov/publications/evaluating-management-alternatives-wyoming-elk-feedgrounds-consideration-chronic

  12. Mysterud A, Rolandsen CM (2018) A reindeer cull to prevent chronic wasting disease in Europe. Nat Ecol Evol 2:1343–1345. https://doi.org/10.1038/s41559-018-0616-1

    Article  PubMed  Google Scholar 

  13. VÃ¥ge J, Hopp P, Tarpai A, Austbo L, Moldal T, Lafond Benestad S (2024) The surveillance programme for chronic wasting disease (CWD) in free ranging and captive cervids in Norway 2023. Annual report. Norwegian Veterinary Institute, Oslo

    Google Scholar 

  14. Hopp P, Rolandsen CM, Korpenfelt S-L, Våge J, Sörén K, Solberg EJ, Averhed G, Pusenius J, Rosendal T, Ericsson G, Bakka HC, Mysterud A, Gavier-Widén D, Hautaniemi M, Ågren E, Isomursu M, Madslien K, Benestad SL, Nöremark M (2024) Sporadic cases of chronic wasting disease in old moose—an epidemiological study. J Gen Virol 105:001952. https://doi.org/10.1099/jgv.0.001952

    Article  CAS  Google Scholar 

  15. Hannaoui S, Triscott E, Duque Velásquez C, Chang SC, Arifin MI, Zemlyankina I, Tang X, Bollinger T, Wille H, McKenzie D, Gilch S (2021) New and distinct chronic wasting disease strains associated with cervid polymorphism at codon 116 of the Prnp gene. PLoS Pathog 17:e1009795. https://doi.org/10.1371/journal.ppat.1009795

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  16. Nonno R, Di Bari MA, Pirisinu L, D’Agostino C, Vanni I, Chiappini B, Marcon S, Riccardi G, Tran L, Vikøren T, Våge J, Madslien K, Mitchell G, Telling GC, Benestad SL, Agrimi U (2020) Studies in bank voles reveal strain differences between chronic wasting disease prions from Norway and north America. Proc Natl Acad Sci U S A 117:31417–31426. https://doi.org/10.1073/pnas.2013237117

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  17. Sun JL, Kim S, Crowell J, Webster BK, Raisley EK, Lowe DC, Bian J, Korpenfelt S-L, Benestad SL, Telling GC (2023) Novel prion strain as cause of chronic wasting disease in a moose, Finland. Emerg Infect Dis 29:323–332. https://doi.org/10.3201/eid2902.220882

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  18. Wadsworth JDF, Joiner S, Linehan JM, Jack K, Al-Doujaily H, Costa H, Ingold T, Taema M, Zhang F, Sandberg MK, Brandner S, Tran L, Vikøren T, Våge J, Madslien K, Ytrehus B, Benestad SL, Asante EA, Collinge J (2022) Humanised transgenic mice are resistant to chronic wasting disease prions from Norwegian reindeer and moose. J Infect Dis 226:933–937. https://doi.org/10.1093/infdis/jiab033

    Article  CAS  PubMed  Google Scholar 

  19. Pirisinu L, Tran L, Chiappini B, Vanni I, Di Bari MA, Vaccari G, Vikøren T, Madslien KI, Våge J, Spraker T, Mitchell G, Balachandran A, Baron T, Casalone C, Rolandsen CM, Røed KH, Agrimi U, Nonno R, Benestad SL (2018) Novel type of chronic wasting disease detected in moose (Alces alces), Norway. Emerg Infect Dis 24:2210–2218. https://doi.org/10.3201/eid2412.180702

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  20. Napper S, Schatzl HM (2023) Vaccines for prion diseases: a realistic goal? Cell Tissue Res 392:367–392. https://doi.org/10.1007/s00441-023-03749-7

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  21. Haley NJ, Merrett K, Buros Stein A, Simpson D, Carlson A, Mitchell G, Staskevicius A, Nichols T, Lehmkuhl AD, Thomsen BV (2019) Estimating relative CWD susceptibility and disease progression in farmed white-tailed deer with rare PRNP alleles. PLoS One 14:e0224342. https://doi.org/10.1371/journal.pone.0224342

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  22. Ishida Y, Tian T, Brandt AL, Kelly AC, Shelton P, Roca AL, Novakofski J, Mateus-Pinilla NE (2020) Association of chronic wasting disease susceptibility with prion protein variation in white-tailed deer (Odocoileus virginianus). Prion 14:214–225. https://doi.org/10.1080/19336896.2020.1805288

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  23. Chafin TK, Douglas MR, Martin BT, Zbinden ZD, Middaugh CR, Ballard JR, Gray MC Jr, White D, Douglas ME (2020) Age structuring and spatial heterogeneity in prion protein gene (PRNP) polymorphism in white-tailed deer. Prion 14:238–248. https://doi.org/10.1080/19336896.2020.1832947

    Article  PubMed  PubMed Central  Google Scholar 

  24. Jewell JE, Conner MM, Wolfe LL, Williams ES (2005) Low frequency of PrP genotype 225SF among free-ranging mule deer (Odocoileus hemionus) with chronic wasting disease. J Gen Virol 86:2127–2134. https://doi.org/10.1099/vir.0.81077-0

    Article  CAS  PubMed  Google Scholar 

  25. Haley N, Donner R, Merrett K, Miller M, Senior K (2021) Selective breeding for disease-resistant PRNP variants to manage chronic wasting disease in farmed whitetail deer. Genes 12:1396. https://doi.org/10.3390/genes12091396

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  26. Saint-Andrieux C, Barboiron A, Guibert B (2017) Trente ans de suivi du cerf en france (1985–2015). Faune Sauvage 314:29–36

    Google Scholar 

  27. Barboiron A (2023) Ongulés. Réseau Ongulés Sauvage Lettre n.°25: 1–48.

  28. CRBAnim. https://doi.org/10.15454/1.5613785622827378E12.

  29. Maniatis T, Fritsch EF, Sambrook JK (1982) Molecular cloning: a laboratory manual, 1st edn. Cold Spring Harbor, New York

    Google Scholar 

  30. CodonCode Aligner. (V10.0.02). (2021). https://www.codoncode.com.December.

  31. QGIS Geographic Information System. QGIS Association. (V3.28.14). http://www.qgis.org. Accessed Dec 2023.

  32. Hill WG, Robertson A (1968) Linkage disequilibrium in finite populations. TAG Theor Appl Genet Theor Angew Genet 38:226–231. https://doi.org/10.1007/BF01245622

    Article  CAS  Google Scholar 

  33. Agresti A (2007) An introduction to categorical data analysis Second edition. Wiley Series in Probability and Statistics, Hoboken

    Book  Google Scholar 

  34. Zeileis A, Meyer D, Hornik K (2007) Residual-based shadings for visualizing (conditional) independence. J Comput Graph Stat 16:507–525. https://doi.org/10.1198/106186007X237856

    Article  Google Scholar 

  35. Meyer D, Zeileis A, Hornik K, Gerber F, Friendly M. (2023) Vcd: visualizing categorical data.

  36. Hijmans RJ, Barbosa M, Ghosh A, Mandel A (2023) Geodata: download geographic data.

  37. Hijmans RJ, Bivand R, Pebesma E, Sumner MD (2024) Terra: spatial data analysis.

  38. Güere ME, Våge J, Tharaldsen H, Kvie KS, Bårdsen B-J, Benestad SL, Vikøren T, Madslien K, Rolandsen CM, Tranulis MA, Røed KH (2022) Chronic wasting disease in Norway—a survey of prion protein gene variation among cervids. Transbound Emerg Dis 69:e20–e31. https://doi.org/10.1111/tbed.14258

    Article  CAS  PubMed  Google Scholar 

  39. Pérez-Espona S, Pérez-Barbería FJ, Goodall-Copestake WP, Jiggins CD, Gordon IJ, Pemberton JM (2009) Genetic diversity and population structure of Scottish Highland red deer (Cervus elaphus) populations: a mitochondrial survey. Heredity 102:199–210. https://doi.org/10.1038/hdy.2008.111

    Article  CAS  PubMed  Google Scholar 

  40. Robinson AL, Williamson H, Güere ME, Tharaldsen H, Baker K, Smith SL, Pérez-Espona S, Krojerová-Prokešová J, Pemberton JM, Goldmann W, Houston F (2019) Variation in the prion protein gene (PRNP) sequence of wild deer in Great Britain and mainland Europe. Vet Res 50:59. https://doi.org/10.1186/s13567-019-0675-6

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  41. Peletto S, Perucchini M, Acín C, Dalgleish MP, Reid HW, Rasero R, Sacchi P, Stewart P, Caramelli M, Ferroglio E, Bozzetta E, Meloni D, Orusa R, Robetto S, Gennero S, Goldmann W, Acutis PL (2009) Genetic variability of the prion protein gene (PRNP) in wild ruminants from Italy and Scotland. J Vet Sci 10:115. https://doi.org/10.4142/jvs.2009.10.2.115

    Article  PubMed  PubMed Central  Google Scholar 

  42. Olano-Marin J, Plis K, Sönnichsen L, Borowik T, Niedziałkowska M, Jędrzejewska B (2014) Weak population structure in European roe deer (Capreolus capreolus) and evidence of introgressive hybridization with Siberian roe deer (C. pygargus) in northeastern Poland. PLoS One 9:e109147. https://doi.org/10.1371/journal.pone.0109147

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  43. Plis K, Niedziałkowska M, Borowik T, Lang J, Heddergott M, Tiainen J, Bunevich A, Šprem N, Paule L, Danilkin A, Kholodova M, Zvychaynaya E, Kashinina N, Pokorny B, Flajšman K, Paulauskas A, Djan M, Ristić Z, Novák L, Kusza S, Miller C, Tsaparis D, Stoyanov S, Shkvyria M, Suchentrunk F, Kutal M, Lavadinović V, Šnjegota D, Krapal AM, Dănilă G, Veeroja R, Dulko E, Jędrzejewska B (2022) Pan-European phylogeography of the European roe deer (Capreolus capreolus). Ecol Evol 12:e8931. https://doi.org/10.1002/ece3.8931

    Article  PubMed  PubMed Central  Google Scholar 

  44. Sommer RS, Fahlke JM, Schmölcke U, Benecke N, Zachos FE (2009) Quaternary history of the European roe deer Capreolus capreolus. Mammal Rev 39:1–16. https://doi.org/10.1111/j.1365-2907.2008.00137.x

    Article  Google Scholar 

  45. Randi E, Alves PC, Carranza J, Milošević-Zlatanović S, Sfougaris A, Mucci N (2004) Phylogeography of roe deer (Capreolus capreolus) populations: the effects of historical genetic subdivisions and recent nonequilibrium dynamics. Mol Ecol 13:3071–3083. https://doi.org/10.1111/j.1365-294X.2004.02279.x

    Article  CAS  PubMed  Google Scholar 

  46. Ernst S, Piestrzyńska-Kajtoch A, Gethmann J, Sadeghi B, Polak MP, Keller M, Gavier-Widén D, Moazami-Goudarzi K, Houston F, Groschup MH, Fast C (2024) Prion protein gene (PRNP) variation in German and Danish cervids. Vet Res 55:98. https://doi.org/10.1186/s13567-024-01340-8

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  47. Pitarch JL, Raksa HC, Arnal MC, Revilla M, Martínez D, Fernández De Luco D, Badiola JJ, Goldmann W, Acín C (2018) Low sequence diversity of the prion protein gene (PRNP) in wild deer and goat species from Spain. Vet Res 49:33. https://doi.org/10.1186/s13567-018-0528-8

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  48. Vikøren T, Våge J, Madslien KI, Røed KH, Rolandsen CM, Tran L, Hopp P, Veiberg V, Heum M, Moldal T, Neves CG, das, Handeland K, Ytrehus B, Kolbjørnsen Ø, Wisløff H, Terland R, Saure B, Dessen KM, Svendsen SG, Nordvik BS, Benestad SL (2019) First detection of chronic wasting disease in a wild red deer (Cervus elaphus) in Europe. J Wildl Dis 55:970–972

    Article  PubMed  Google Scholar 

  49. Pereira JC, Gonçalves-Anjo N, Orge L, Pires MA, Rocha S, Figueira L, Matos AC, Silva J, Mendonça P, Carvalho P, Tavares P, Lima C, Alves A, Esteves A, Pinto ML, Pires I, Gama A, Sargo R, Silva F, Seixas F, Vieira-Pinto M, Bastos E (2023) Estimating sequence diversity of prion protein gene (PRNP) in Portuguese populations of two cervid species: red deer and fallow deer. Prion 17:75–81. https://doi.org/10.1080/19336896.2023.2191540

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  50. Zachos FE, Frantz AC, Kuehn R, Bertouille S, Colyn M, Niedziałkowska M, Pérez-González J, Skog A, Sprĕm N, Flamand MC (2016) Genetic structure and effective population sizes in European red deer (Cervus elaphus) at a continental scale: insights from microsatellite DNA. J Hered 107:318–326. https://doi.org/10.1093/jhered/esw011

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  51. Skog A, Zachos FE, Rueness EK, Feulner PGD, Mysterud A, Langvatn R, Lorenzini R, Hmwe SS, Lehoczky I, Hartl GB, Stenseth NC, Jakobsen KS (2009) Phylogeography of red deer (Cervus elaphus) in Europe. J Biogeogr 36:66–77. https://doi.org/10.1111/j.1365-2699.2008.01986.x

    Article  Google Scholar 

  52. Frantz AC, Zachos FE, Bertouille S, Eloy MC, Colyn M, Flamand MC (2017) Using genetic tools to estimate the prevalence of non-native red deer (Cervus elaphus) in a western European population. Ecol Evol 7:7650–7660. https://doi.org/10.1002/ece3.3282

    Article  PubMed  PubMed Central  Google Scholar 

  53. Mattioli S, Zachos FE, Rossi L, Lister AM, Corlatti L (2022) Red Deer Cervus elaphus Linnaeus, 1758. In: Hackländer K, Zachos FE (eds) Handbook of the mammals of Europe. Springer International Publishing, Cham, pp 1–37

    Google Scholar 

  54. Niedziałkowska M, Jędrzejewska B, Honnen AC, Otto T, Sidorovich VE, Perzanowski K, Skog A, Hartl GB, Borowik T, Bunevich AN, Lang J, Zachos FE (2011) Molecular biogeography of red deer Cervus elaphus from eastern Europe: insights from mitochondrial DNA sequences. Acta Theriol 56:1–12. https://doi.org/10.1007/s13364-010-0002-0

    Article  Google Scholar 

  55. Leduc D, Klein F (2004) Origine des populations de cerfs présents en France. Faune Sauvage 264:27–28

    Google Scholar 

  56. Schnitzler A, Granado J, Putelat O, Arbogast R-M, Drucker D, Eberhard A, Schmutz A, Klaefiger Y, Lang G, Salzburger W, Schibler J, Schlumbaum A, Bocherens H (2018) Genetic diversity, genetic structure and diet of ancient and contemporary red deer (Cervus elaphus L.) from north-eastern France. PLoS One 13:e0189278. https://doi.org/10.1371/journal.pone.0189278

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  57. Dellicour S, Frantz AC, Colyn M, Bertouille S, Chaumont F, Flamand MC (2011) Population structure and genetic diversity of red deer (Cervus elaphus) in forest fragments in north-western France. Conserv Genet 12:1287–1297. https://doi.org/10.1007/s10592-011-0230-0

    Article  Google Scholar 

  58. Plaff E, Klein F, Saint-Andrieux C, Guibert B (2008) La situation du cerf élaphe en France. Faune Sauvage 280:40–50

    Google Scholar 

  59. Moazami-Goudarzi K, Andréoletti O, Vilotte JL, Béringue V (2021) Review on PRNP genetics and susceptibility to chronic wasting disease of Cervidae. Vet Res 52:128. https://doi.org/10.1186/s13567-021-00993-z

    Article  PubMed  PubMed Central  Google Scholar 

  60. Roh IS, Kim YC, Won SY, Jeong MJ, Park KJ, Park HC, Lee YR, Kang HE, Sohn HJ, Jeong BH (2022) First report of a strong association between genetic polymorphisms of the prion protein gene (PRNP) and susceptibility to chronic wasting disease in sika deer (Cervus nippon). Transbound Emerg Dis 69:e2073–e2083. https://doi.org/10.1111/tbed.14543

    Article  CAS  PubMed  Google Scholar 

  61. Ehsani S, Huo H, Salehzadeh A, Pocanschi CL, Watts JC, Wille H, Westaway D, Rogaeva E, St George-Hyslop PH, Schmitt-Ulms G (2011) Family reunion–the ZIP/prion gene family. Prog Neurobiol 93:405–420. https://doi.org/10.1016/j.pneurobio.2010.12.001

    Article  CAS  PubMed  Google Scholar 

  62. Kawahara M, Kato-Negishi M, Tanaka KI (2021) Neurometals in the pathogenesis of prion diseases. Int J Mol Sci 22:1267. https://doi.org/10.3390/ijms22031267

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  63. Legname G (2023) Copper coordination modulates prion conversion and infectivity in mammalian prion proteins. Prion 17:1–6. https://doi.org/10.1080/19336896.2022.2163835

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  64. Gielnik M, Szymańska A, Dong X, Jarvet J, Svedružić ŽM, Gräslund A, Kozak M, Wärmländer SKTS (2023) Prion protein octarepeat domain forms transient β-sheet structures upon residue-specific binding to Cu(II) and Zn(II) ions. Biochemistry. https://doi.org/10.1021/acs.biochem.3c00129

    Article  PubMed  Google Scholar 

  65. Guadagno AH, Medina SH (2023) The manifold role of octapeptide repeats in prion protein assembly. Pept Sci 115:e24303. https://doi.org/10.1002/pep2.24303

    Article  CAS  Google Scholar 

  66. Castilla J, Gutiérrez-Adán A, Brun A, Pintado B, Salguero FJ, Parra B, Segundo FDS, Ramírez MA, Rábano A, Cano MJ, Torres JM (2005) Transgenic mice expressing bovine PrP with a four extra repeat octapeptide insert mutation show a spontaneous, non-transmissible, neurodegenerative disease and an expedited course of BSE infection. FEBS Lett 579:6237–6246. https://doi.org/10.1016/j.febslet.2005.09.099

    Article  CAS  PubMed  Google Scholar 

  67. Brun A, Gutiérrez-Adán A, Castilla J, Pintado B, Díaz-San Segundo F, Cano MJ, Alamillo E, Espinosa JC, Torres JM (2007) Reduced susceptibility to bovine spongiform encephalopathy prions in transgenic mice expressing a bovine PrP with five octapeptide repeats. J Gen Virol 88:1842–1849. https://doi.org/10.1099/vir.0.82568-0

    Article  CAS  PubMed  Google Scholar 

  68. Castilla J, Gutiérrez-Adán A, Brun A, Pintado B, Parra B, Ramírez MA, Salguero FJ, Segundo FDS, Rábano A, Cano MJ, Torres JM (2004) Different behavior toward bovine spongiform encephalopathy infection of bovine prion protein transgenic mice with one extra repeat octapeptide insert mutation. J Neurosci 24:2156–2164. https://doi.org/10.1523/JNEUROSCI.3811-03.2004

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  69. Hara H, Sakaguchi S (2020) n-terminal regions of prion protein: functions and roles in prion diseases. Int J Mol Sci 21:6233. https://doi.org/10.3390/ijms21176233

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  70. Hara H, Miyata H, Chida J, Sakaguchi S (2023) Strain-dependent role of copper in prion disease through binding to histidine residues in the n-terminal domain of prion protein. J Neurochem 167:394–409. https://doi.org/10.1111/jnc.15971

    Article  CAS  PubMed  Google Scholar 

  71. Assessing and controlling the risks associated with the emergence of chronic wasting disease in Europe—EU-CWD. https://anr.fr/Projet-ANR-20-CE35-0015.

  72. Tackling chronic wasting disease in Europe—TCWDE. https://ec.europa.eu/programmes/horizon2020/en

Download references

Acknowledgements

We are grateful to the local hunting federations and the hunters who contributed to this work by collecting and shipping biological materials to the OFB, the Laboratoires Vétérinaires Départementaux and ELIZ (Entente de Lutte et d’Intervention contre les Zoonoses), or the National Hunting Federation (FNC). We thank Matthieu Bastien and Benoît Combes at ELIZ, and Eva Faure at FNC who coordinated shipment or DNA extractions for samples transiting through their respective institutions. Finally, we are also very grateful to Clara Le Lay who greatly helped manage the CEFS sample collection early in the project, and Mark Hewison who initiated the project at CEFS. This project was partly subsidized by the French Ecocontribution fund.

Funding

This work was supported by a grant overseen by the French National Research Agency (ANR) in 2020 under the CE 35 scientific evaluation committee, under grant agreement n°00005793 with the acronym Eu- CWD [71]. This research was made possible by funding from ICRAD, an ERA-NET co-funded under European Union’s Horizon 2020 research and innovation programme, under Grant Agreement n°862605 [72].

Author information

Authors and Affiliations

Authors

Contributions

Study design and manuscript writing: AVDW, HV, SF, FH, V Béringue, OA, V Bourret, JLV and KMG. Sample collection: AVDW, AB, CSA, MP, EM, JM, V Bourret, HV. DNA preparation, PCR: JC, NDC, BP, JM, V Bourret, JL and KMG. Sample analysis: JL and KMG. Cloning: SE, JL and KMG. Statistical analysis: DL and KMG. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Katayoun Moazami-Goudarzi.

Ethics declarations

Competing interests

The authors declare that they have no competing interests.

Additional information

Handling editor: Marie Galloux.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Laubier, J., Van De Wiele, A., Barboiron, A. et al. Variation in the prion protein gene (PRNP) open reading frame sequence in French cervids. Vet Res 55, 105 (2024). https://doi.org/10.1186/s13567-024-01362-2

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s13567-024-01362-2

Keywords