Skip to main content

Table 1 Primer sequences used in qRT–PCR assays

From: Luteolin increases susceptibility to macrolides by inhibiting MsrA efflux pump in Trueperella pyogenes

Gene Orientation Sequence (5′-3′)
msrA Forward GGCATACTATCGTCAACTTG
Reverse ATACTGCTAACGATAATTTCG
16S rRNA Forward ATGCAACGCGAAGAACCTTACC
Reverse TTAACCCAACATCTCACGACAC