Skip to main content

Table 1 PCR primers.

From: Deleting qseC downregulates virulence and promotes cross-protection in Pasteurella multocida

Primer Sequence(5’-3’) Product size (bp)
qseC 5’Arm-F GACCATGATTACGCCAAGCTTTGATTGCACGTTTGCAGGCA 350
qseC 5’Arm-R TTTTATATAATTAAGCCATTTCATCATTTT
qseC 3’Arm-F AATGGCTTAATTATATAAAAGGATTTAGAT 350
qseC 3’Arm-R TTTATCGGTACCCGGGGATCCAGCGAGATTATTCTACACCG
dqseC-F GCAAACAAGTTTACGAGTTC 1300
dqseC-R CACATTTTCTAACCGGAATTG
pUC19-F GAGCGGATAACAATTTCACAC 151
pUC19-R ATTTAAGAATACCTTGCCGC
KMT1-F ATCCGCTATTTACCCAGTGG 460
KMT1-R GCTGTAAACGAACTCGCCAC
egfp-F GACCATGATTACGCCAAGCTTCCGCGCCAACCGATAAAACC 1111
egfp-R TTTATCGGTACCCGGGGATCCCAATTCGCCCTATAGTGAGT
comqseC-F CTAGTGAATTCTGCAGTCGACATGAAATGGCTTAAGCAAAC 1374
comqseC-R TGGCCGTCGTTTTACTCTAGATTAAATTTTATTTAATAAAA