Skip to main content

Table 1 Primer used in this study.

From: Heat shock protein 70 could enhance porcine epidemic diarrhoea virus replication by interacting with membrane proteins

Primer Sequence (5′-3′)
PEDV E F CTCGAGGCCACCATGCTACAATTAGTGAATGATAATG
PEDV E R AGATCTTACGTCAATAACAGTACTGGGGAGGG
PEDV M F CTCGAGGCCACCATGTCTAACGGTTCTATTCCCGTTG
PEDV M R AGATCTGACTAAATGAAGCACTTTCTCACTATC
PEDV N F CTCGAGGCCACCATGGCTTCTGTCAGCTTTCAGGATC
PEDV N R GGATCCATTTCCTGTATCGAAGATCTCGTTG
PEDV S F CTCGAGGCCACCATGAAGTCTTTAAATTACTTCTGG
PEDV S R GGTACCCTGCACGTGGACCTTTTCAAAAAC
HSP70 F GATCTCGCCACCATGGCCAAAGCCGCGGCGATC
HSP70 R CTCGAGATCTACCTCCTCAATGGTGGGGC
qHSP70 F AACGCCCTGGAGTCATACGC
qHSP70 R TCTTCTTGTCGGCCTCGCTG
qPEDV M F CGTACAGGTAAGTCAATTAC
qPEDV M R GATGAAGCATTGACTGAA
qGAPDH F CCTTCCGTGTCCCCACTGCCAAC
qGAPDH R GACGCCTGCTTCACCACCTTCT
  1. Kozak sequence is underlined. Start codon is bolded. Italic sequence denotes restriction enzyme site.