Skip to main content

Table 1 qRT-PCR primers

From: Glaesserella parasuis serotype 4 HPS4-YC disrupts the integrity of the swine tracheal epithelial barrier and facilitates bacterial translocation

Gene Forward Reverse
ZO-1 GGGTGTTGAGCTCCATAGAAA GTCTCGGCAGACCTTGAAATA
occludin CGGATTCTGTCTATGCTCGTTAT TAGCCCATACCACCTCCTATT
IL-6 GGAGACCTGCTTGATGAGAATC CAGCCTCGACATTTCCCTTAT
IL-8 TTCTGCAGCTCTCTGTGAGGC GGTGGAAAGGTGTGGAATGC
TNF-α CCTACTGCACTTCGAGGTTATC ACGGGCTTATCTGAGGTTTG
GAPDH GATGCTGGTGCTGAGTATGT GGCAGAGATGATGACCCTTT