Skip to main content

Table 2 Full names and abbreviations of gene names, primer sequences, length of amplicons, annealing temperature and access to GenBank for selected reference genes

From: Expression of cytokines in dairy cattle mammary gland parenchyma during chronic staphylococcal infection

Reference genes
Gene Forward primer Reverse primer Amplicon (bp) Annealing temperature in real-time PCR [°C] GenBank Accession Number
GAPDH (glyceraldehyde-3-phosphate dehydrogenase) ACCACTTTGGCATCGTGGAG GGGCCATCCACAGTCTTCTG 75 60° U85042
HPRT (hypoxanthine–guanine phosphoribosyltransferase) TGCTGAGGATTTGGAGAAGG CAACAGGTCGGCAAAGAACT 154 60° NW_001501830
  1. *Primers designed using Primer 3 0.4.0.