Skip to main content

Table 1 Full names and abbreviations of gene names, primer sequences, length of amplicons, annealing temperature and access to GenBank, and/or source of chosen primers from the literature of the tested genes.

From: Expression of cytokines in dairy cattle mammary gland parenchyma during chronic staphylococcal infection

Gene Forward primer (F)
Reverse primer (R)
Amplicon (bp) Annealing temperature [°C] GenBank Accession Number References
CXCL5 (F) TGAGACTGCTATCCAGCCG 193 61 AF149249 [34]
(R) AGATCACTGACCGTTTTGGG
TNFα (F) CGGTGGTGGGACTCGTATG 352 60 NM_173966.3 [35]
(R) CTGGTTGTCTTCCAGCTTCACA
IL-18 (F) GAAAATGATGAAGACCTGGAATCA 84 60 NM_174091.2 [35]
(R) AACTTGGTCATTCAATTTCGTATGA
IL-1β* (F) AGAAAAGCCCGTCTTCCTGG 87 60 X12498.1
(R) GGCTTTCTTTAGGGAGAGAGGG
IL-6* (F) TGCAGTCTTCAAACGAGTGG 156 60 NM_173923.2
(R) TCTGACCAGAGGAGGGAATG
CCR1 (F) CTGCTGGTGATGATTGTCTG 191 61° NM_001077839 [36]
(R) TGCTCTGCTCACACTTACGG
CCL2 (F) CCCTCCTGTGCCTGCTACT 284 61° NM_174006 [37]
(R) TGCTCTGCTCACACTTACGG
  1. *Primers designed using Primer 3 0.4.0.