Skip to main content

Table 2 Primers used for real-time fluorescence quantitative PCR

From: Mutual regulation between chicken telomerase reverse transcriptase and the Wnt/β-catenin signalling pathway inhibits apoptosis and promotes the replication of ALV-J in LMH cells

Gene Primer sequence (5’-3’) Reference
chTERT F: GTAAGACTAAGCCGTGTTGTTG [23]
R: CTCCCGAATACTGAAGAGC
β-catenin F: GCCCTGCTCAACAAGACAAA [54]
R: CTGACAACACCTTCAGCACC
Cyclin D1 F: TCGTTCGAACCCCTCAAGAA [54]
R: GCGGTCAGAGGAATCGTTTC
TCF4 F: CCCTTACCCAACAGCTCTGA [54]
R: CTATGGCCGGATGAGGGATT
c-Myc F: AGCGACTCGGAAGAAGAACAAG [55]
R: ATCGACTTCGCTTGCTCAGACT
BCL-2 F: ATCGTCGCCTTCTTCGAGTT [49]
R: ATCCCATCCTCCGTTGTCCT
BAX F: TGGATTCTCACAGTAGGAGGATG [49]
R: CGTAGACCTTGCGGATAAAGC
BCL-X F: CTTTCAGCGACCTCACCTC [49]
R: ACAATGCGTCCCACCAGT
Caspase 9 F: CCGAAGGAGCAAGCACG [56]
R: AGGTTGGACTGGGATGGAC
Caspase 3 F: CATCTGCATCCGTGCCTGA [56]
R: CTCTCGGCTGTGGTGGTGAA
ALV-J F: TGTGTGCGTGGTTATTATTTC [57]
R: AATGGCGAGGTCGCTGACTGC
GAPDH F: GGAAAGTCATCCCTGAGCTG [23]
R: GGTCAACAACAGAGACATTGG