Skip to main content

Table 1 Primers used for gene cloning and expression analysis

From: Mutual regulation between chicken telomerase reverse transcriptase and the Wnt/β-catenin signalling pathway inhibits apoptosis and promotes the replication of ALV-J in LMH cells

Primer namea Primer sequence (5’-3’)
chTERT-T1-F (Xba I) CTCTACTAGAGGATCtctagaCGTGGGGCCCGCTGCACGGCAGCGb
chTERT-T1-R ATACGCAGTCATTCACTCTCATCTTCCACATC
chTERT-T2-F GCCATAACAAATGCCGGTTCTTTAAAAACGTG
chTERT-T2-R GGGGTACCAGACCTTCATCCCTTAGTCCAG
chTERT-T2-linker-F GTGATCCGCTCCTCAGGGAGCTGCTCAGGCAGCACAGCA
GCCACTGGCAGGTGTATGGCTTTGTGAGGG
chTERT-T2-linker-R CGATCCGCCACCGCCAGAGCCACCTCCGCCTGAACCGCC
TCCACCGGTACCGTCCAGTATAGTTTTGAAAT
chTERT-T2-HA-F GTGATCCGCTCCTCAGGGAGCTGCTCAGGCAGCACAGCA
GCCACTGGCAGGTGTATGGCTTTGTGAGGG
chTERT-T2-HA-R
(Xho I)
GGGCCCGGGTTCGAActcgagTTAAGCGTAGTCTGGGACGT
CGTATGGGTATCGCGACGATCCGCCACCGCCAGAGCCAC2
  1. aF: forward primer, R: reverse primer
  2. bThe lowercase letters indicate restriction sites