Skip to main content

Table 2 Primers and TaqMan probe sequences used for RT-qPCR

From: A detailed analysis of innate and adaptive immune responsiveness upon infection with Salmonella enterica serotype Enteritidis in young broiler chickens

Cell type Genes NCBI Reference TaqMan/SYBR-Green Type Sequence (5ʹ-3ʹ)
NK cells NFIL3 XM_017014743.1 SYBR-Green Forward TGAATGCCATCAGTTGAGC
Reverse GAGAGGCGGAGAATGTGAGT
IL-7Rα NM_001080106.1 SYBR-Green Forward ATTCTGGGAAAGCAGGATCAAG
Reverse CTTACACAGTCGCTCCAGAGTTATTT
PRF1 XM_004945690.3 SYBR-Green Forward ACCCGCACCAAAAGATGAAG
Reverse TAATTCGCACACCCCTAAACG
GAPDH NM_204305.1 SYBR-Green Forward GTGGTGCTAAGCGTGTTATC
Reverse GCATGGACAGTGGTCATAAG
APCs CD14 NM_001139478.1 TaqMan Forward GGACGACTCCACCATTGACAT
Reverse GGAGGACCTCAGGAACCAGAA
Probe AATGATCTTCCTGATTTGCAGACTGCCAA
TLR4 NM_001030693.1 SYBR-Green Forward GTCCCTGCTGGCAGGAT
Reverse TGTCCTGTGCATCTGAAAGCT
MERTK NM_204988.1 SYBR-Green Forward TGTGGAAGGATGGCAGGGAG
Reverse GCACGGATGCTGAATGTAGAGG
MAFB NM_001030852.1 SYBR-Green Forward AGGACCGGTTCTCGGATGAC
Reverse CCTCGGAGGTGCCTGTTG
INOS NM_204961.1 SYBR-Green Forward TGGGTGGAAGCCGAAATA
Reverse GTACCAGCCGTTGAAAGGAC
ZBTB46 XM_015296613.2 SYBR-Green Forward CTGGACCTGTGGAAGAGGAAAC
Reverse CGGTAGTGGGAGGCAATCTC
XCR1 NM_001024644.2 SYBR-Green Forward CCTTCGGGTGGATTTTTGGT
Reverse CGCTGTAGTAGCCAATGGAGAA
FLT3 NM_004119.3 SYBR-Green Forward CATTCGGACCCAGTACATGTTTAC
Reverse TGAGCCGTAGAAGAGCAGGTATAA
GAPDH NM_204305.1 SYBR-Green Forward GTGGTGCTAAGCGTGTTATC
Reverse GCATGGACAGTGGTCATAAG
28S XR_00378040.1 TaqMan Forward GGCGAAGCCAGAGGAAACT
Reverse GACGACCGATTTGCACGTC
Probe AGGACCGCTACGGACCTCCACCA
  1. All sequences have been described previously except for NFIL3 and PRF1 [57, 58, 79].