Skip to main content

Table 1 Forward and reverse primer sequences used for RT-qPCR analysis

From: Transcriptomic analysis of equine chorioallantois reveals immune networks and molecular mechanisms involved in nocardioform placentitis

Gene Forward Reverse Accession Amplicon size (bp)
IL1β CAGTCTTCAGTGCTCAGGTTTCTG CATTGCCGCTGCAGTAAGT XM_001495926.4 84
IL1RN GCCTGTGTCAAGTCTGGTGA ACTCTTTGGGCTTGTTGGTG XM_005599766.3 217
IL6 GGATGCTTCCAATCTGGGTTCAAT TCCGAAAGACCAGTGATGATTTT NM_001082496.2 65
PLAC8 GTTTCATGTGCCTTGCGTTGT ATATCGGGTCCGGTAGAGGG XM_003364673.4 98
SAA1 CCTGGGCTGCTAAAGTCATC AGGCCATGAGGTCTGAAGTG XM_023646155.1 169
INHBA CCTCCTCTTCCTTCTTCTTCTTCTT GCAAGAGCTCCCTGGATATT XM_023638729.1 99
GUSB GGGATTCGCACTGTGGCTGTCA CCAGTCAAAGCCCTTCCCTCGGA XM_001493514 117
ACTB CGACATCCGTAAGGACCTGT CAGGGCTGTGATCTCCTTCT NM_001081838 100
  1. Primers were generated using Primer-BLAST (NCBI).
  2. Key: RT-qPCR, Real time quantitative polymerase chain reaction; NCBI, National Center for Biotechnology Information; IL1β, Interleukin 1β; IL1RN, Interleukin 1 Receptor Antagonist; IL6, Interleukin 6; PLAC8, Placenta-specific 8; SAA1, Serum Amyloid A1; INHBA, Inhibin Subunit Beta A; ACTB, actin beta; GUSB, Glucuronidase Beta.