Skip to main content

Table 2 Primers for mutagenesis and RT-qPCR in this study

From: Structural comparison of CD163 SRCR5 from different species sheds some light on its involvement in porcine reproductive and respiratory syndrome virus-2 infection in vitro

Primer Sequencea
Mutagenesis
 pCD163-G499R, forward GTACAACATGGAGACACGTGGcgcACCGTCTGTGATTCTGAC
 pCD163-G499R, reverse GTCAGAATCACAGACGGTgcgCCACGTGTCTCCATGTTGTAC
 pCD163-E509H, forward GTGATTCTGACTTCTCTCTGcacGCGGCCAGCGTGCTGTGC
 pCD163-E509H, reverse GCACAGCACGCTGGCCGCgtgCAGAGAGAAGTCAGAATCAC
 pCD163-S512N, forward GACTTCTCTCTGGAGGCGGCCaacGTGCTGTGCAGGGAACTAC
 pCD163-S512N, reverse GTAGTTCCCTGCACAGCACgttGGCCGCCTCCAGAGAGAAGTC
 pCD163-T522D, forward GAACTACAGTGCGGCgacGTGGTTTCCCTC
 pCD163-T522D, reverse CAGGAGGGAAACCACgtcGCCGCACTGTAGTTC
 pCD163-E534K, forward CTGGGGGGAGCTCACTTTGGAaaaGGAAGTGGACAGATCTG
 pCD163-E534K, reverse CAGATCTGTCCACTTCCtttTCCAAAGTGAGCTCCCCCCAG
 pCD163-E543K, forward GTGGACAGATCTGGGCTGAAaaaTTCCAGTGTGAGGGGCACGAG
 pCD163-E543K, reverse CTCGTGCCCCTCACACTGGAAtttTTCAGCCCAGATCTGTCCAC
 pCD163-H549S, forward GAAGAATTCCAGTGTGAGGGGagcGAGTCCCACCTTTCACTCTG
 pCD163-H549S, reverse CAGAGTGAAAGGTGGGACTCgctCCCCTCACACTGGAATTCTTC
 pCD163-P560Q, forward CTTTCACTCTGCCCAGTAGCAcaaCGCCCTGACGGGACATGTAGC
 pCD163-P560Q, reverse GCTACATGTCCCGTCAGGGCGttgTGCTACTGGGCAGAGTGAAAG
 pCD163-R561H, forward CACTCTGCCCAGTAGCACCCcacCCTGACGGGACATGTAGCCAC
 pCD163-R561H, reverse GTGGCTACATGTCCCGTCAGGgtgGGGTGCTACTGGGCAGAGTG
 pCD163-G564D, forward CAGTAGCACCCCGCCCTGACgacACATGTAGCCACAGCAGGGAC
 pCD163-G564D, reverse GTCCCTGCTGTGGCTACATGTgtcGTCAGGGCGGGGTGCTACTG
 pCD163-E534K/R561H, forward CGGCGTAGTCTGCTCAAGATACACACAAATC
 pCD163-E534K/R561H, reverse CTCCAACCAGCCTGGGTTTCCTGTGGGCTG
RT-qPCR
 PRRSV-ORF7, forward AAACCAGTCCAGAGGCAAGG
 PRRSV-ORF7, reverse GCAAACTAAACTCCACAGTGTAA
 GAPDH, forward CCTTCCGTGTCCCTACTGCCAAC
 GAPDH, reverse GACGCCTGCTTCACCACCTTCT
  1. aThe lowercase letters indicate mutated sites.