Skip to main content

Table 1 Primers for amplification of the full-length GAPDH, porin and Fe(3+) ABC transporter substrate-binding protein genes

From: Characterization and protective activity of monoclonal antibodies directed against Fe (3+) ABC transporter substrate-binding protein of Glaesserella parasuis

Gene Primer sequences (5′–3′) Restriction sites Length (bp)
GAPDH GCGGATCCATGGCAATTAAAATTG BamHI 1021
GCAAGCTTTTAGCCTTTGTAGTTG HindIII
Porin CGCGAGCTCAAAAAAACACTAGTAGCATTAGC SacI 1081
CGCGAGCTCAAAAAATCTCTTTCTGTGCTTGC XhoI
Fe (3+) ABC transporter substrate-binding protein CGCGAGCTCAAAAAATCTCTTTCTGTGCTTGC SacI 1020
CGCCTCGAGTTTCGCACCGAAATCATCAAATT SacI