Skip to main content

Table 1 Primers used for quantitative real-time PCR

From: Damage to intestinal barrier integrity in piglets caused by porcine reproductive and respiratory syndrome virus infection

Gene name Sense (5’-3’)-forward Antisense (5’-3’)-reverse
GAPDH TCGGAGTGAACGGATTTGGC TGACAAGCTTCCCGTTCTCC
ZO1 AGGCGTGTTTAACAGCAACG CCAAAGGACTCAGCAGGGTT
OCLN TCGTCCAACGGGAAAGTGAA ATCAGTGGAAGTTCCTGAACCA
CLDN1 TGGAAGATTTACTCCTACGCTGG TCCCAGCAGGATGCCAATTACC
MUC2 GGACGCCTACAAGGAGTTCG ACCAGCTGCTGAGTGAGGTA
PRRSV N Gene AGAAGCCCCATTTCCCTCTA CGGATCAGACGCACAGTATG
IL-1β CCCAAAAGTTACCCGAAGAGG TCTGCTTGAGAGGTGCTGATG
IL-6 ACAAAGCCACCACCCCTAAC CGTGGACGGCATCAATCTCA
IL-8 TTCACAAGTCTCTGCTCAACTG TGTCCTCAAGGTAGGATGGG
TNF-α CCCTCACGTCCTTCTGGTTT GAGTCTGGAAGCCCCAGTTC