Skip to main content

Table 1 Sequences of the primers used for RT-qPCR.

From: Antiviral effects of ergosterol peroxide in a pig model of porcine deltacoronavirus (PDCoV) infection involves modulation of apoptosis and tight junction in the small intestine

Primers name Directiona Sequence (5′ → 3′)
PDCoV F ACCTGTTTCCTTCGCCTTGA
R ACAGCGTCTGGTTGAGTTCC
IL-1β F AACGTGCAGTCTATGGAGT
R GAACACCACTTCTCTCTTCA
IL-6 F CTGGCAGAAAACA ACCTGAACC
R TGATTCTCATCAAGCAGGTCTCC
IL-12 F CGTGCCTCGGGCAATTATA
R CGCAGGTGAGGTCGCTAGTT
TNF-α F AACCTCAGATAAGCCCGTCG
R ACCACCAGCTGGTTGTCTTT
IFN-α F TCTCATGCACCAGAGCCA
R CCTGGACCACAGAAGGGA
IFN-β F AGTGCATCCTCCAAATCGCT
R GCTCATGGAAAGAGCTGTGGT
β-actin F TGACTGACTACCTCATGAAGATCC
R TCTCCTTAATGTCACGCACGATT
  1. aF = forward; R = reverse.