Skip to main content

Table 1 Primer sequences used in this study

From: A newly identified Hippo homologue from the oriental river prawn Macrobrachium nipponense is involved in the antimicrobial immune response

Primer name Sequence (5ʹ-3ʹ)
MnHippo-F GATTCGTTCTCCCAGCAGCAGTCCCCTC
MnHippo-R TCTGGTTGCCACTGGTCAGGCTCACG
MnHippo-gF1 TGACACTGACCTTCAGGAAATC
MnHippo-gR1 AATACTCTAGGCCACGCAAAG
MnHippo-gF2 AGATAGCGACAGTTATCCTA
MnHippo-gR2 ACTCCATATATCTGCAACAC
MnHippo-gF3 GCTGGTAACATTCTGCTAAATACTC
MnHippo-gR3 GTGATGTGCTTGATTTGGATCTG
MnHippo-gF4 GAACTCCTCCAACACCAGTTTA
MnHippo-gR4 TGTTAGGTATGCTGTGGTGATG
MnHippo-gF5 GTACAGGTCTGGAGGAGATAGT
MnHippo-gR5 CCTGGAGCTGTATCATGTCTTT
MnHippo-qF TTTGCGTGGCCTAGAGTATTT
MnHippo-qR CGCATGGCCCTGAGTATTTA
β-actin-qF TATGCACTTCCTCATGCCATC
β-actin-qR AGGAGGCGGCAGTGGTCAT
MnHippo-RT-F GGTGACTTCCAGGGTGAAATAA
MnHippo-RT-R CCACGCAAAGTGTCTAGGATAA
β-actin-RT-F AATGTGTGACGACGAAGTAG
β-actin-RT-R GCCTCATCACCGACATAA
MnHippo-dsRNA-F GCGTAATACGACTCACTATAGGGAGCAAGAAAAGAAGGC
MnHippo-dsRNA-R GCGTAATACGACTCACTATAGGCTGCAGCAACTCCTCTTG
GFP-dsRNA-F GCGTAATACGACTCACTATAGGTGGTCCCAATTCTCGTGGAAC
GFP-dsRNA-R GCGTAATACGACTCACTATAGGCTTGAAGTTGACCTTGATGCC
MnALF1-qF GTGGTGCCCAGGATGGACTT
MnALF1-qR AGAGGATGGTGGAGGAAATT
MnALF4-qF GGCAGAGGGCCAAGAATTAG
MnALF4-qR GAATTCCAAGTCACCTGTCTCC
MnCru5-qF ACACCCCAATCACCCCCCA
MnCru5-qR TGCCTTGAAACGGCTCCCT
MnCru7-qF GACCTGCCTGTCCCCCCGT
MnCru7-qR CCCCACACCTCAGCCCAAA
MnLyso2-qF GGCAAGACAGAAAGAGAGAGAG
MnLyso2-qR GAGACCGCTGAAACCACTAAA