Skip to main content

Table 1 PCR primers used for the construction of PRRSV infectious clones.

From: Chimeric HP-PRRSV2 containing an ORF2-6 consensus sequence induces antibodies with broadly neutralizing activity and confers cross protection against virulent NADC30-like isolate

No Primer Sequence (5ʹ-3ʹ)a Length (bp)
1 JSTZ1712-12-PacI-F1 AGCTCGTTAATTAATACATGACGTATAGGTGTTGGCT 37
2 JSTZ1712-12-AflII-R1 CATAGGTGCTTAAGTTCATTACCACCTGTAACGGAT 36
3 JSTZ1712-12-AflII-F2 ATCCGTTACAGGTGGTAATGAACTTAAGCACCTATG 36
4 JSTZ1712-12-AscI-R2 CCTTTCTGGCGCGCCCGAAAC 21
5 JSTZ1712-12-AscI-F3 GTTTCGGGCGCGCCAGAAAGG 21
6 JSTZ1712-12-1R3 AGCGAGGAGGCTGGGACCATGCCGGCCTTTTTTTTTTTTTTTTTTTTTAATTACGGCCGCATGGTTCT 68
7 JSTZ1712-12-NotI-2R3 ACAGGCGGCCGCGTCCCATTCGCCATTACCGAGGGGACGGTCCCCTCGGAATGTTGCCCAGCCGGCGCCAGCGAGGAGGCTGGGACCATb 89
8 PRRSV2-AscI-ORF2-CON-F3 TTTCGGGCGCGCCAGAAAGGGAAAATTTATAAAGCTAATGCCACCAGCATGAGGTTTCATTTTCCCCCGGGCCCT 75
9 PRRSV2-ORF6-CON-R TTCTTTTTCTTTTGCTGCTTGCCGTTGTTATTTGGCATATTTGACAAGGTTTACCACTCCCTGT 64
10 PRRSV2-ORF6-CON-F2 ACAGGGAGTGGTAAACCTTGTCAAATATGCCAAATAACAACGGCAAGCAGCAAAAGAAAAAGAA 64
  1. aThe unique restriction enzyme sites used for cloning purposes are underlined.
  2. bThe hepatitis D virus ribozyme sequence is shown in italic and the overlapped region is highlighted in bold.