Skip to main content

Table 1 Primer sequences used for qRT-PCR analysis

From: Long non-coding RNA LNC_000641 regulates pseudorabies virus replication

Primer Sequence (5′→3′) Product
IFN-alpha-Fwd TCCAGAAACCTGCAAGACAG IFN-alpha
IFN-alpha-Rev ATGGGCTTGTTAGTCTGTGAG
IFN-beta-Fwd ACCACAGCTCTTTCCATGAG IFN-beta
IFN-beta-Rev CAGGGACCTCAAAGTTCATCC
IFN-gamma-Fwd AATGGTAGCTCTGGGAAACTG IFN-gamma
IFN-gamma-Rev ACTTCTCTTCCGCTTTCTTAGG
18s rRNA-Fwd CGTTGATTAAGTCCCTGCCCTT 18s rRNA
18s rRNA-Rev TCAAGTTCGACCGTCTTCTCAG
U2snRNA-Fwd CATCGCTTCTCGGCCTTTTG U2snRNA
U2snRNA-Rev TGGAGGTACTGCAATACCAGG
gB-Fwd GTCCGTGAAGCGGTTCGTGAT PRV-gB
gB-Rev ACAAGTTCAAGGCCCACATCTAC
β-actin-Fwd GTGATCTCCTTCTGCATCCTGTC β-actin
β-actin-Rev CTCCATCATGAAGTGCGACGT
lnc641-Fwd CAGGCATAGAGGGTTAAGGAC lnc641
lnc641-Rev ACGCTTTGCATGTGGAATTC
ALD1114-Fwd GGTGGGCAAAAGAACTTAGTG ALD1114
ALD1114-Rev GATAAGAACACGGCTCCCTG
lnc1007-Fwd CTCAGTGGGTTAATGATCCGG lnc1007
lnc1007-Rev CATATGGAGGTTCCCAGGTTAG
ALD8954-Fwd AAGTGGTACAAGACAGTGTGG ALD8954
ALD8954-Rev GGAGGTTGGAGGTAAAAGGAC
lnc1059-Fwd TCTTGGGCTCTGCAAATGAG lnc1059
lnc1059-Rev AAGGCTCCTTCTGTCTTGTTC