Skip to main content

Table 1 Primers used in quantitative real-time PCR

From: Expression analysis of tissue factor pathway inhibitors TFPI-1 and TFPI-2 in Paralichthys olivaceus and antibacterial and anticancer activity of derived peptides

Primers Sequences (5′-3′)
Po-Actin RTF ACCGCTGCCTCCTCCTCAT
Po-Actin RTR TCGGGACAACGGAACCTCTC
TFPI-1 RTF GATGTTGTCCAAGCAACTGAAG
TFPI-1 RTR GACTGAAGCACAGCCTCTTAT
TFPI-2 RTF GGAAATGCTCGGCCTCTATTA
TFPI-2 RTR CTCTGCCTGGAGACAAAGTT