Skip to main content

Table 1 Detailed information on the discovered tandem repeats during gap analysis

From: Genomic diversity of Mycobacterium avium subsp. paratuberculosis: pangenomic approach for highlighting unique genomic features with newly constructed complete genomes

Name of TR Position of tandem repeats on M. avium subsp. paratuberculosis (K-10) genome Length of TR (bp) Sequence of TR
Start Stop
MAPK_TR_1 83 156 83 195 20 AATTAACGATATCGAATTTG
MAPK_TR_2 127 386 127 400 15 CCGCCGACCAGCTCT
MAPK_TR_3 703 849 703 948 57 ACGACCATTAAACAAGGAGTGATCGCGAGCGCGGGCGAAGCCCGGGTGAAGCGGGTC
MAPK_TR_4 1 798 372 1 798 524 51 CCCGGCGGCGGCGGTGGCAGCATCCCCGGTGGCCCGACCGGTGGCGGCGGC
MAPK_TR_5 2 156 149 2 156 235 21 CGCCGCGCCCGTCGAGCGTCA
MIRU292 3 253 654 3 253 812 53 GTCATCTGCGCCGCTCCTCCTCATCGCTGCGCTCTGCATCGTCGTCGGCGCGA
VNTR25 3 665 698 3 665 855 58 CTCCTGCGCATCCCGCTGCGCGGAATGCTTCGTCGCCGGGCTCCACCCCAATCACCCA