Skip to main content

Table 1 Primers used in this study.

From: Two CD9 tetraspanin family members of Japanese flounder (Paralichthys olivaceus): characterization and comparative analysis of the anti-infectious immune function

Primer name Sequence (5′–3′)
PoCD9.1F GTCGACATGGCCGCGCTGTCGG (SalI)
PoCD9.1R CTCGAGCACCACCTCCCGAGATTTCC (XhoI)
PoCD9.3F GTCGACATGGCGGCTCTGACCAGCT (SalI)
PoCD9.3R CTCGAGGACAAAGTCTCTGGACCTCTTG (XhoI)
PoCD9.1RTF TATGCTGGGACTGTTCTTTGG
PoCD9.1RTR GCAGCAGTTCAGCCCTGTTT
PoCD9.3RTF TGGTCGTCGGCTTCCTCG
PoCD9.3RTR CCTTCAGGGCTTCTTGTTTGG
siPoCD9.1-F1 GATCACTAATACGACTCACTATAGGGCCTGGTGTTCTGGCTTGCATT
siPoCD9.1-R1 AATGCAAGCCAGAACACCAGGCCCTATAGTGAGTCGTATTAGTGATC
siPoCD9.1-F2 AACCTGGTGTTCTGGCTTGCACCCTATAGTGAGTCGTATTAGTGATC
siPoCD9.1-R2 GATCACTAATACGACTCACTATAGGGTGCAAGCCAGAACACCAGGTT
siPoCD9.1-CF1 GATCACTAATACGACTCACTATAGGGATCGCGTCGTCGTCGTGTTTT
siPoCD9.1-CR1 AAAACACGACGACGACGCGATCCCTATAGTGAGTCGTATTAGTGATC
siPoCD9.1-CF2 AAATCGCGTCGTCGTCGTGTTCCCTATAGTGAGTCGTATTAGTGATC
siPoCD9.1-CR2 GATCACTAATACGACTCACTATAGGGAACACGACGACGACGCGATTT
siPoCD9.3-F1 GATCACTAATACGACTCACTATAGGGGGAGACGCTGCGTCTCATCTT
siPoCD9.3-R1 AAGATGAGACGCAGCGTCTCCCCCTATAGTGAGTCGTATTAGTGATC
siPoCD9.3-F2 AAGGAGACGCTGCGTCTCATCCCCTATAGTGAGTCGTATTAGTGATC
siPoCD9.3-R2 GATCACTAATACGACTCACTATAGGGGATGAGACGCAGCGTCTCCTT
siPoCD9.3-CF1 GATCACTAATACGACTCACTATAGGGATCGATCGATCGTCGTCTCTT
siPoCD9.3-CR1 AAGAGACGACGATCGATCGATCCCTATAGTGAGTCGTATTAGTGATC
siPoCD9.3-CF2 AAATCGATCGATCGTCGTCTCCCCTATAGTGAGTCGTATTAGTGATC
siPoCD9.3-CR2 GATCACTAATACGACTCACTATAGGGGAGACGACGATCGATCGATTT
Poβ-actinRTF GGACATCCGTAAGGACCTGT
Poβ-actinRTR GCCTCCGATCCATACAGAGT
EFα-1RTF CTACAAGTGCGGAGGAATCG
EFα-1RTF GTCCAGGAGCGTCAATGATG