Skip to main content

Table 1 The primers used in the experiments

From: UL28 and UL33 homologs of Marek’s disease virus terminase complex involved in the regulation of cleavage and packaging of viral DNA are indispensable for replication in cultured cells

Primers Sequences Purpose
Del UL28 kana F CACACAAATCTTTATATTTTCTCACACGTCGGTTGTGCGGGATTGAAGCAGGATGACGACGATAAGTAGGG Primers with the UL28 homologous sequences for amplification of the KanR cassette gene
Del UL28 kana R ATAAATTGTGTGAGATAAAATGCAGGGACACAAGAATATTGGACGGGTCAGCTTCAATCCCGCACAACCGACGTGTGAGAAAATATAAAGATTTGTGTGCAACCAATTAACCAATTCTGATTAG
UL28 BamHI F GATCGGATCCCAAATGGAGTTGGAGGAC Primers for PCR identification of the UL28 gene in Figure 3A
UL28 ApaI R GATCGGGCCCGTTCTAGACGGATCACGG
UL28 XHOI KANA.3 GATCCTCGAGCAACCAATTAACCAATTCTGATTAG Primers for construction of the UL28 revertant mutant
UL28 XHOI KANA.5 CTCGAGGCATTGGTATCCAAAGAACGTCTTTTCGATCTGAGAACCTCAATAGGATGACGACGATAAGTAGGG
Meq Star US CCGCACACTGATTCCTAG Primers for PCR and RT-PCR amplification of the meq gene
Meq End US CCTTTATGTTGATCTTCCCG
Pet30a-UL28 BamHI F GATCGGATCCTTGGGAATGTCTCATAACCG Primers for PCR identification of the UL28 gene in Figure 5A
Pet30a-UL28 NotI R GATCGCGGCCGCAGATGGGGGCGTGGCTG
UL28 F1 TTTCGATCTGAGAACCTCA Primers for RT-PCR identification of the UL28 gene in Figure 5B
UL28 R1 ATAATGCTGTATTCGACGG
Del UL33 kana F TTCTCCAGAAGATCGGATAAAAGCTGCCAACTCTGTAGGGCGGTTGGCCAGGATGACGACGATAAGTAGGG Primers with the UL33 homologous sequences for amplification of the KanR cassette gene
Del UL33 kana R AACAGTCCTAACAGTCTTTCAAAATTTGATGTAAATCGAGGAACCTATTAGGCCAACCGCCCTACAGAGTTGGCAGCTTTTATCCGATCTTCTGGAGAACAACCAATTAACCAATTCTGATTAG
UL33 HindIII F1 GATCAAGCTTATGCCACATAGGGTTC Primers for PCR identification of the UL33 gene in Figure 3B
UL33 BamHI R1 GATCGGATCCGTTCGGAATGACTTCCATC
UL33 PstI Kana.5 GATCCTGCAGTGAGTAACAATAGCTCCTCAAATTCGTATGGAAGCACCGAGCACGTCTGAGGATGACGACGATAAGTAGGG Primers for construction of the UL33 revertant mutant
UL33 PstI Kana.3 GATCCTGCAGCAACCAATTAACCAATTCTGATTAG