Skip to main content

Table 1 Primer information table of this research.

From: DDX1 from Cherry valley duck mediates signaling pathways and anti-NDRV activity

Primer name Sequence (5′–3′) Purpose
JDDX1-F CACCCTAAAGCGGCATCTCT Gene cloning
JDDX1-R TCAAGCCTTGTCTCAAGTGTG Gene cloning
gDDX1-F CTTGGTACCGAGCTCGGATCCGCCACCATGGCGGCGTTCTCGGAAATGGGTGTTATGC Gene cloning
gDDX1-R CTCTAGACTCGAGCGGCCGCTCAGAATGTTCTGAACAGCT Gene cloning
qDDX1-F GAACCTTCCAAATGCTCCAA qRT-PCR
qDDX1-R AGCTTCATCCAGAACGAGGA qRT-PCR
qIFN-α-F TCCTCCAACACCTCTTCGAC qRT-PCR
qIFN-α-R GGGCTGTAGGTGTGGTTCTG qRT-PCR
qIFN-β-F AGATGGCTCCCAGCTCTACA qRT-PCR
qIFN-β-R AGTGGTTGAGCTGGTTGAGG qRT-PCR
qIFN-γ-F GCTGATGGCAATCCTGTTTT qRT-PCR
qIFN-γ-R GGATTTTCAAGCCAGTCAGC qRT-PCR
qPKR-F AATTCCTTGCCTTTTCATTCAA qRT-PCR
qPKR-R TTTGTTTTGTGCCATATCTTGG qRT-PCR
qMx-F TGCTGTCCTTCATGACTTCG qRT-PCR
qMx-R GCTTTGCTGAGCCGATTAAC qRT-PCR
qOAS-F TCTTCCTCAGCTGCTTCTCC qRT-PCR
qOAS-R ACTTCGATGGACTCGCTGTT qRT-PCR
qIL-1β-F TCATCTTCTACCGCCTGGAC qRT-PCR
qIL-1β-R GTAGGTGGCGATGTTGACCT qRT-PCR
qIL-6-F TTCGACGAGGAGAAATGCTT qRT-PCR
qIL-6-R CCTTATCGTCGTTGCCAGAT qRT-PCR
qIL-8-F AAGTTCATCCACCCTAAATC qRT-PCR
qIL-8-R GCATCAGAATTGAGCTGAGC qRT-PCR
qMDA5-F GCTACAGAAGATAGAAGTGTCA qRT-PCR
qMDA5-R CAGGATCAGATCTGGTTCAG qRT-PCR
qRIG-I-F GCTACCGCCGCTACATCGAG qRT-PCR
qRIG-I-R TGCCAGTCCTGTGTAACCTG qRT-PCR
qTLR-2-F AAGAAAATGGAGCTGCTGGA qRT-PCR
qTLR-2-R GAAAAACACAGCGCAGATCA qRT-PCR
qTLR-3-F GAGTTTCACACAGGATGTTTAC qRT-PCR
qTLR-3-R GTGAGATTTGTTCCTTGCAG qRT-PCR
qTLR-4-F ACCCATTGTCACCAACATCATC qRT-PCR
qTLR-4-R TGCCTCAGCAAGGTCTTATTCA qRT-PCR
qNDRV-F TGAGTGGCTGGGAACTGT qRT-PCR
qNDRV-R CCATAAAGGAAGCAGAAG qRT-PCR
qGAPDH-F ATGTTCGTGATGGGTGTGAA qRT-PCR
qGAPDH-R CTGTCTTCGTGTGTGGCTGT qRT-PCR