Skip to main content

Table 1 Primer sequences with their corresponding PCR product size.

From: Activation of ChTLR15/ChNF-κB-ChNLRP3/ChIL-1β signaling transduction pathway mediated inflammatory responses to E. tenella infection

Genes Primers sequences (5′-3′) Restriction recognition sites PCR product (base pairs)
ChNLRP3 ChNLRP3/600-F1 CGGGGTACCATGGCAGGAGAAGAAAGCACCAT Kpn I 600 bp
ChNLRP3/600-R1 CCGCTCGAGGTCAAACTGTGTGCAGAGGGTCC Xho I
ChTLR15 ChTLR15/CDS-F1 ATAGAATTCATGAGGATCCTTATTGGG EcoR I 2607 bp
ChTLR15/CDS-R1 CCGCTCGAGTCATTCCATCTCAATTACA Xho I
ChTLR15 ChTLR15-F GGCTGTGGTATGTGAGAATG 113 bp
ChTLR15-R ATCGTGCTCGCTGTATGA
ChMyD88 ChMyD88-F CTGGCATCTTCTGAGTAGT 76 bp
ChMyD88-R TTCCTTATAGTTCTGGCTTCT
ChNF-κB ChNF-κB –F TCTGAACAGCAAGTCATCCATAACG 253 bp
ChNF-κB –R AAGGAAGTGAGGTTGAGGAGTCG
ChNLRP3 ChNLRP3-F GGTTTACCAGGGGAAATGAGG 252 bp
ChNLRP3-R TTGTGCTTCCAGATGCCGT
ChCaspase-1 ChCaspase-1-F TAAGCACTTGAGACAGCGGGACG 245 bp
ChCaspase-1-R GGATGTCCGTGGTCCCATTACTC
ChIL-1β ChIL-1β-F TTCCGCTACACCCGCTCACAGT 242 bp
ChIL-1β-R CCGCTCATCACACACGACAT
ChIL-18 ChIL-18-F CAGCGTCCAGGTAGAAGATAAG 210 bp
ChIL-18-R TCCTCAAAGGCCAAGAACAT
β-actin β-actin-F GCCAACAGAGAGAAGATGACAC 139 bp
β-actin-R GTAACACCATCACCAGAGTCCA
  1. The restriction enzyme sites in primer sequences are underlined.