Skip to main content

Table 1 Primers used for real-time PCR

From: PEDV infection in neonatal piglets through the nasal cavity is mediated by subepithelial CD3+ T cells

Gene Primer sequence (5′-3′) Orientation
IFN-α CTCTTCCTCCAGAAACCTGCAA Forward
GAGGAAGAATGGGCTTGTTAGTC Reverse
IFN-β CCACCACAGCTCTTTCCATGA Forward
TGAGGAGTCCCAGGCAACT Reverse
IL-1β AGAGGGACATGGAGAAGCGA Forward
GCCCTCTGGGTATGGCTTT Reverse
TNF-a GCCCTTCCACCAACGTTTTC Forward
TCCCAGGTAGATGGGTTCGT Reverse
IL-6 CCTCGGCAAAATCTCTGCAA Forward
TGAAACTCCACAAGACCGGT Reverse
IL-8 CCTCATTCCTGTGCTGGTCA Forward
TGCAAGTTGAGGCAAGAAGAC Reverse
IL-10 CGGCCCAGTGAAGAGTTTCT Forward
TGCCTTCGGCATTACGTCTT Reverse
TLRl AGATTTCGTGCCACCCTATG Forward
CCTGGGGGATAAACAATGTG Reverse
TLR2 GAGTCTGCCACAACTCAAAGA Forward
CAGAACTGACAACATGGGTAGAA Reverse
TLR3 GAGCAGGAGTTTGCCTTGTC Forward
GGAGGTCATCGGGTATTTGA Reverse
TLR4 TCATCCAGGAAGGTTTCCAC Forward
TGTCCTCCCACTCCAGGTAG Reverse
TLR5 GGTCCCTGCCTCAGTATCAA Forward
TGTTGAGAAACCAGCTGACG Reverse
TLR6 TCAAGCATTTGGACCTCTCA Forward
TTCCAAATCCAGAAGGATGC Reverse
TLR7 TCTGCCCTGTGATGTCAGTC Forward
GCTGGTTTCCATCCAGGTAA Reverse
TLR8 CTGGGATGCTTGGTTCATCT Forward
CATGAGGTTGTCGATGATGG Reverse
TLR9 AGGGAGACCTCTATCTCCGC Forward
AAGTCCAGGGTTTCCAGCTT Reverse
TLRl0 GCCCAAGGATAGGCGTAAAT Forward
CTCGAGACCCTTCATTCAGC Reverse
β-actin TGCTGTCCCTGTATGCCTCT Forward
CTTTGATGTCACGCACGATTT Reverse