Skip to main content

Table 2 Primers used for cloning PCR

From: The serine-48 residue of nucleolar phosphoprotein nucleophosmin-1 plays critical role in subcellular localization and interaction with porcine circovirus type 3 capsid protein

Gene product Sense primer (5′–3′) Antisense primer (5′–3′)
PCV3 Cap(1-214aa) ATGAGACACAGAGCTATATTC TTAGAGAACGGACTTGTAACGAATC
PCV3 Cap(35-214aa) ATGGCTGGCACATACTACACAAAGAAAT TTAGAGAACGGACTTGTAACGAATC
PCV3 Cap(1-34aa) ATGAGACACAGAGCTATATTC TTA TGTGGGCCTCCTAATGAATA
NPM1(1-294aa) ATGGAAGATTCGATGGATAT TTAAAGAGACTTCCTCCACT
NPM1(1-117aa) ATGGAAGATTCGATGGATAT TACTAAGTGCTGTCCACTAATATGC
NPM1(118-188aa) GCTGTAGAGGAAGATGCAGAGT TTCCGCTTCCTCATCATCAAA
NPM1(189-294aa) GAAAAAGCTCCAGTAAAGAAAT TTAAAGAGACTTCCTCCACT
NPM1(1-188aa) ATGGAAGATTCGATGGATAT TTCCGCTTCCTCATCATCAAA
NPM1(118-294aa) GCTGTAGAGGAAGATGCAGAGT TTAAAGAGACTTCCTCCACT
NPM1(1-117aa + 189-294aa) ATGGAAGATTCGATGGATAT CTTTACTGGAGCTTTTTCTACTAAGTGCTGTCCACTA
TAGTGGACAGCACTTAGTAGAAAAAGCTCCAGTAAAG TTAAAGAGACTTCCTCCACT
ATGGAAGATTCGATGGATAT TTAAAGAGACTTCCTCCACT
NPM1-S48A TTATCTTTAAGAACGGTCGCATTAGGGGCT AGCCCCTAATGCGACCGTTCTTAAAGATAA
NPM1-S48E TTATCTTTAAGAACGGTCGAATTAGGGGCTGGCGCAAA TTTGCGCCAGCCCCTAATTCGACCGTTCTTAAAGATAA
NPM1-S88A AACTTTGAAAATGTCTGTACAGCCGACGGTTGCACTTG CAAGTGCAACCGTCGGCTGTACAGACATTTTCAAAGTT
NPM1-S88E AACTTTGAAAATGTCTGTACAGCCGACGGTTGAACTTG CAAGTTCAACCGTCGGCTGTACAGACATTTTCAAAGTT
NPM1-T95A TTGGGGGCTTTGAAATAGCACCACCTGTGGTCTTA TAAGACCACAGGTGGTGCTATTTCAAAGCCCCCAA
NPM1-T95D TTGGGGGCTTTGAAATAGATCCACCTGTGGTCTTA TAAGACCACAGGTGGATCTATTTCAAAGCCCCCAA
NPM1-S48T TTATCTTTAAGAACGGTCACATTAGGGGCT AGCCCCTAATGTGACCGTTCTTAAAGATAA
NPM1-S48D AAAATGAGCACCAGTTATCTTTAAGAACGGTCGATTTA TAAATCGACCGTTCTTAAAGATAACTGGTGCTCATTTT
NPM1-S48K TTATCTTTAAGAACGGTCAAATTAGGGGCTGGCGCAAA TTTGCGCCAGCCCCTAATTTGACCGTTCTTAAAGATAA
NPM1-S48R TTATCTTTAAGAACGGTCAGATTAGGGGCTGGCGCAAA TTTGCGCCAGCCCCTAATCTGACCGTTCTTAAAGATAA