Skip to main content

Table 2 Sequences of the primers used in real-time RT-PCR reaction

From: Regulatory effects of chicken TRIM25 on the replication of ALV-A and the MDA5-mediated type I interferon response

Primer name Sequence (5′ to 3′) Accession number
Forward Reverse
GAPDH GGTGGTGCTAAGCGTGTTA CCCTCCACAATGCCAA NM_204305
TRIM25 TACAACCACCACCCTCA GATGCCAATGCCACAG NM_001318458.1
MDA5 TGAAAGCCTTGCAGATGACTTA GCTGTTTCAAATCCTCCGTTAC AB371640.1
MAVS CACCCACGAGGTCCATGTG TGCTTCATCTGGGACATCATTG NM_001012893.1
IFN-β TCCAGCTCCTTCAGAATACG TGCGGTCAATCCAGTGTT NM_001024836