Skip to main content

Table 1 Primers for construction of pPICZα A-Nbs-pFc plasmids and detection of PRRSV ORF7 and cytokines

From: Nanobody Nb6 fused with porcine IgG Fc as the delivering tag to inhibit porcine reproductive and respiratory syndrome virus replication in porcine alveolar macrophages

Gene Primer Sequence (5′–3′)
Nbs-pFc Forward GGTGAATTCCAGGTCCAACTGCAGGAGTC
Reverse GGGTCTAGATCACTTGCCCTGTGTCTTGC
PRRSV ORF7 Forward AGATCATCGCCCAACAAAAC
Reverse GACACAATTGCCGCTCACTA
PAM IL-1β Forward CCTTGAAACGTGCAATGATGACT
Reverse GTGGAGAGCCTTCAGCATGT
PAM IL-6 Forward CCGGTCTTGTGGAGTTTCAG
Reverse CAGGGTCTGGATCAGTGCTT
PAM IL-8 Forward CCAGCATTCACAAGTCTTCTTGC
Reverse ATGTCCTCAAGGTAGGATGGGG
PAM IL-10 Forward GCATCCACTTCCCAACCA
Reverse TCGGCATTACGTCTTCCAG
PAM IL-12p40 Forward GTTTCAGACCCGACGAACTC
Reverse GAGGACCACCATTTCTCCAG
PAM IFN-α Forward ACTTCCACAGACTCACCCTCTATC
Reverse ATGACTTCTGCCCTGATGATCT
PAM IFN-β Forward TGCAACCACCACAATTCC
Reverse CTGAGAATGCCGAAGATCTG
PAM TNF-α Forward AGCCGCATCGCCGTCTCCTAC
Reverse CCTGCCCAGATTCAGCAAAGTCC
GAPDH Forward CCTTCCGTGTCCCTACTGCCAAC
Reverse GACGCCTGCTTCACCACCTTCT
  1. Underlined and italicized nucleotides sequences are the restriction enzyme cutting sites nucleotides and the termination codon, respectively