Skip to main content

Table 1 Genes and primers used in the study.

From: Cannabis-derived cannabidiol and nanoselenium improve gut barrier function and affect bacterial enzyme activity in chickens subjected to C. perfringens challenge

Gene Primer Sequence (5′-3′) Melting temperature (°C) Product size (nt) GenBank accession no.
ACTB Forward CGGACTGTTACCAACACCCA 58 115 NM_205518
Reverse TCCTGAGTCAAGCGCCAAAA  
GAPDH Forward GCACGCCATCACTATCTT 58 82 NM_204305
Reverse GGACTCCACAACATACTCAG  
ZO-1 Forward TCGCTGGTGGCAATGATGTT 58 89 XM_413773
Reverse TTGGTCTCCTTCCTCTAATCCTTCTT  
GLP2 Forward TGTGTTCAGACGGTAAGG 58 127 NM_001163248
Reverse TCATCCAGTGCCATCTTC  
HSP70 Forward GGCAATAAGCGAGCAGTG 58 146 NM_001006685
Reverse CGAGTGATGGAGGTGTAGAA  
TFF2 Forward ACTACCCTACTGAGAGAACAAA 58 143 XM_416743
  Reverse CTGAAGAACCTGCTCAACTG    
TLR4 Forward CAAGCACCAGATAGCAACA 58 146 FJ915527
  Reverse CACTACACTACTGACAGAACAC    
JAM2 Forward TCCTCCCACTACTCCAATATG 58 134 XM_026849998
  Reverse ACTGCCTGTTCCTGTCTT    
  1. ACTB β-actin, GAPDH glyceraldehyde-3-phosphate dehydrogenase, ZO-1 Zonula occludens-1, GLP2 Glucagon-like peptide-2, HSP70 Heat Shock Protein 70, TFF2 Trefoil Factor 2, TLR4 Toll-like Receptor 4, JAM2 Junctional Adhesion Molecule 2.