Skip to main content

Table 2 Gene-specific primers flanked by T7 RNA polymerase promoter sequences

From: RNAi-mediated silencing of Trichinella spiralis serpin-type serine protease inhibitors results in a reduction in larval infectivity

Primer Sense (5′–3′)
TsSPI dsRNA-566 F GGTCGTTCGTTTCATCGC
TsSPI dsRNA-566 R AGCACCGCTAACTTTGGA
TsSPI dsRNA-566 T7 F TAATACGACTCACTATAGGG GGTCGTTCGTTTCATCGC
TsSPI dsRNA-566 T7 R TAATACGACTCACTATAGGG AGCACCGCTAACTTTGGA
dsGFP F TCCTGGTCGAGCTGGACGG
dsGFP T7 F TAATACGACTCACTATAGGG TCCTGGTCGAGCTGGACGG
dsGFP R CGCTTCTCGTTGGGGTCTTTG
dsGFP T7 R TAATACGACTCACTATAGGG CGCTTCTCGTTGGGGTCTTTG
  1. The underlined portion is the T7 promoter sequence