Skip to main content

Table 1 Primers of reverse transcription and RT-PCR.

From: Differential expression of microRNA between normally developed and underdeveloped female worms of Schistosoma japonicum

Primer Primer sequence (5′ → 3′)
NADPH forward GAGGACCTAACAGCAGAGG
NADPH reverse TCCGAACGAACTTTGAATTC
Common reverse GTGCAGGGTCCGAGGT
Let-7 SLP GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACACCACA
Let-7 RP GTGTTTTG GGAGGTAGTTCGTTG
Mir-1 SLP GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACGACCAT
Mir-1 RP GTGTTTTGTGGAATGTGGCGAAGT
Mir-10-5p SLP GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACCCAAAC
Mir-10-5p RP GTGTTTTG AACCCTGTAGACCCGA
Mir-61-5p SLP GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACAAGTGA
Mir-61-5p FP GTGTTTTGTGACTAGAAAGTGCAC
Mir-124-3p SLP GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACTGACAT
Mir-124-3p RP GTGTTTTG TAAGGCACGCGGTGA
Mir-3479-3p SLP GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACCAAGGC
Mir-3479-3p RP GTGTTTTG TATTGCACTTACCTTC