Skip to main content

Table 1 Genes and primers used in this study

From: Dihydromyricetin attenuates Escherichia coli lipopolysaccharide-induced ileum injury in chickens by inhibiting NLRP3 inflammasome and TLR4/NF-κB signalling pathway

Names Accession No. Forward primer (5′ to 3′) Reverse primer (5′ to 3′) Product
GAPDH NM_204305.1 GACGTGCAGCAGGAACACTA ATGGCCACCACTTGGACTTT 122 bp
bcl-2 NM_205339.2 GAGTTCGGCGGCGTGATGTG TTCAGGTACTCGGTCATCCAGGTG 92 bp
bax XM_015290060.2 CGCAAGGTCTACGCCATCATCTC GCAGCAGACCAGCACCAAGTAG 165 bp
caspase-3 NM_204725.1 TACCGGACTGTCATCTCGTTCAGG ACTGCTTCGCTTGCTGTGATCTTC 166 bp
NLRP3 NM_001348947.1 GCTCCTTGCGTGCTCTAAGACC TTGTGCTTCCAGATGCCGTCAG 150 bp
caspase-1 XM_025142104.1 GTGCTGCCGTGGAGACAACATAG AGGAGACAGTATCAGGCGTGGAAG 179 bp
IL-1β NM_204524.1 AGCAGCCTCAGCGAAGAGACC GTCCACTGTGGTGTGCTCAGAATC 90 bp
IL-18 NM_204608.1 AGATGATGAGCTGGAATGCGATGC ATCTGGACGAACCACAAGCAACTG 97 bp
IL-6 NM_204628.1 ATGGTGATAAATCCCGATGAAG CCTCACGGTCTTCTCCATAAAC 153 bp
IL-8 HM179639.1 ACACTCCTAACCATGAACGGCAAG CTGGCACCGCAGCTCATTCC 114 bp
TNF-α AY765397.1 CTCAGGACAGCCTATGCCAACAAG GCCACCACACGACAGCCAAG 178 bp
IL-10 NM_001004414.2 CAGCACCAGTCATCAGCAGAGC GCAGGTGAAGAAGCGGTGACAG 94 bp