Skip to main content

Table 2 Genes and primers used in the study.

From: The effect of different dietary ratios of lysine and arginine in diets with high or low methionine levels on oxidative and epigenetic DNA damage, the gene expression of tight junction proteins and selected metabolic parameters in Clostridium perfringens-challenged turkeys

GenePrimerSequence (5′-3′)Melting temperature (°C)Product size (nt)GenBank access no.
ACTBForwardTACCCCATTGAACACGGCAT5896NM_001303173
ReverseCTCCTCAGGGGCTACTCTCA 
GAPDHForwardAGGATACACAGAGGACCAGGTTG5871NM_001303179
ReverseCCGCATCAAAGGTGGAGGAATG 
ZO-1ForwardAGAGGCAACTGAACCATAG58114XM_019619275
ReverseCTGCTGAGAGGCTAATACAA 
GLP2ForwardGCAGTGAAGGAGAAGTGA58200XM_010721176
ReverseGAGGCTGTAAGAAGTAGGA 
OCLNForwardGCAGATGTCCAGCAGTTA55127XM_019610822
ReverseGTTCACACTCACCTCCTG 
TFF2ForwardAAAATAGCAGCCAGGGAGCG5892XM_010724393
 ReverseACTGACGCATTGAAGCAGCA   
CLDN15ForwardGCAAGGAGGCTTCTGAAA55161XM_019618905
 ReverseCAGTAACTATGTGGCAAGGT   
OGG1ForwardGGGACAAATGGGCACCTG58102XM_010718590
 ReverseGCAGAGGCAATAGGCTCAG   
  1. ACTB: β-actin, GAPDH: Glyceraldehyde-3-Phosphate Dehydrogenase, ZO-1: Zonula occludens-1, GLP2: Glucagon-like peptide-2, OCLN: Occludin, TFF2: Trefoil Factor 2, CLDN15: Claudin 15, and OGG1: 8-Oxoguanine glycosylase.