Skip to main content

Table 2 List of the primers used in RT-qPCR analysis of mRNA expression of selected host genes

From: GtxA is a virulence factor that promotes a Th2-like response during Gallibacterium anatis infection in laying hens

Name Primer Primer sequence(5′–3′) Accession Conc. (mM)
bcl-2 Forward GATGACCGAGTACCTGAACC NM205339 0.2
Reverse CAGGAGAAATCGAACAAAGGC
bax Forward TCCTCATCGCCATGCTCAT XM422067 0.4
Reverse CCTTGGTCTGGAAGCAGAAGA
caspase-8 Forward TGGCCCTCTTGAACTGAAAG AY057940 0.4
Reverse TCCACTGTCTGCTTCAATACC
caspase-9 Forward CGAAGGAGCAAGCACGACAG AY057940 0.2
Reverse CCGCAGCCCTCATCTAGCAT
caspase-3 Forward TGGCCCTCTTGAACTGAAAG AY057940 0.4
Reverse TCCACTGTCTGCTTCAATACC
IL-6 Forward GCTCGCCGGCTTCGA AJ250838 0.2
Reverse GGTAGGTCTGAAAGGCGAACAG
IL-4 Forward AACATGCGTCAGCTCCTGAAT AJ621735 0.4
Reverse TCTGCTAGGAACTTCTCCATTGAA
IL-10 Forward CATGCTGCTGGGCCTGAA J621614 0.4
Reverse CGTCTCCTTGATCTGCTTGATG
TNF-α Forward GCCCTTCCTGTAACCAGATG NM_204267 0.2
Reverse ACACGACAGCCAAGTCAACG
β-actin Forward CCGCTCTATGAAGGCTACGC L08165 0.4
Reverse CTCTCGGCTGTGGTGGTGAA