Skip to main content

TableĀ 1 List of qRT-PCR primers

From: Porcine circovirus type 2 exploits JNK-mediated disruption of tight junctions to facilitate Streptococcus suis translocation across the tracheal epithelium

Gene Forward Reverse
GAPDH GATGCTGGTGCTGAGTATGT GGCAGAGATGATGACCCTTT
occludin CGGATTCTGTCTATGCTCGTTAT TAGCCCATACCACCTCCTATT
ZO-1 GGGTGTTGAGCTCCATAGAAA GTCTCGGCAGACCTTGAAATA