Skip to main content

Table 3 Short hairpin RNA (shRNA) sequences

From: Antiviral activity of ISG15 against classical swine fever virus replication in porcine alveolar macrophages via inhibition of autophagy by ISGylating BECN1

shRNASequence (5′–3′)
shISG15-1-FGATCCGACCAGTTCTGGCTGACTTTCCAAGAGGAAAGTCAGCCAGAACTGGTCTTTTTG
shISG15-1-RAATTCAAAAAGACCAGTTCTGGCTGACTTTCCTCTTGGAAAGTCAGCCAGAACTGGTCG
shISG15-2-FGATCCGCCTATGTGCACCGTGTATATCAAGAGATATACACGGTGCACATAGGCTTTTTG
shISG15-2-RAATTCAAAAAGCCTATGTGCACCGTGTATATCTCTTGATATACACGGTGCACATAGGCG
shISG15-3-FGATCCGTGCACCGTGTATATGAATCTCAAGAGAGATTCATATACACGGTGCACTTTTTG
shISG15-3-RAATTCAAAAAGTGCACCGTGTATATGAATCTCTCTTGAGATTCATATACACGGTGCACG
shUSP18-1-FGATCCGGTCGGTTTGCACAACATTGGCAAGAGCCAATGTTGTGCAAACCGACCTTTTTG
shUSP18-1-RAATTCAAAAAGGTCGGTTTGCACAACATTGGCTCTTGCCAATGTTGTGCAAACCGACCG
shUSP18-2-FGATCCGCCTTAACTCCCTGATTCAGGCAAGAGCCTGAATCAGGGAGTTAAGGCTTTTTG
shUSP18-2-RAATTCAAAAAGCCTTAACTCCCTGATTCAGGCTCTTGCCTGAATCAGGGAGTTAAGGCG
shUSP18-3-FGATCCGCCTACTGTCTCCAGAAGTACCAAGAGGTACTTCTGGAGACAGTAGGCTTTTTG
shUSP18-3-RAATTCAAAAAGCCTACTGTCTCCAGAAGTACCTCTTGGTACTTCTGGAGACAGTAGGCG
  1. Underlines show loop ring.