Skip to main content

Table 2 Primers used for plasmid construction

From: Antiviral activity of ISG15 against classical swine fever virus replication in porcine alveolar macrophages via inhibition of autophagy by ISGylating BECN1

PrimerSequence (5′–3′)Usage
CMV-ISG15-FCGGAATTCATGGGTAGGGAACTGAAGGTGAAGAAmplification of ISG15
CMV-ISG15-RCGGGATCCGCACTCGGTGGGGTGCTCCC
3.1-ISG15AA-A2TGGCCCTGTCCCCGCCGCCCGCAGGCGCAGAmplification of ISG15 mutant
3.1-ISG15AA-B1CTGCGCCTGCGGGCGGCGGGGACAGGGCCA
Flag-ISG15-FCGGAATTCTATGGGTAGGGAACTGAAGGTGAAGAAmplification of ISG15
Flag-ISG15-RCGGGATCCGCACTCGGTGGGGTGCTCC
Myc-BECN1-FCGGAATTCTATGGAGGGGTCTAAGACATCCAAmplification of BECN1
Myc-BECN1-RCGGGATCCTTTGTTATAAAACTGTGAGGATACCC
Flag-BECN1-FCGGAATTCCATGGAGGGGTCTAAGACATCCAAmplification of BECN1
Flag-BECN1-RCGGGATCCTTTGTTATAAAACTGTGAGGATACCC
Flag-ISG15-BECN1-A2CTACAGAATCTGGGGAGGTAGCCCCCCCGCAGGCGCAGATTAmplification of ISG15-BECN1
Flag-ISG15-BECN1-B1ATCTGCGCCTGCGGGGGGGCATGGAGGGGTCTAAGACATCCA
Myc-HERC5-FTGC TCTAGA ATGGAGCGGAGACCACGGAGAmplification of HERC5
Myc-HERC5-RCG GGATCC GCCAAATCCCCTGTGGTTGC
GST-BECN1-FCGGAATTCATGGAGGGGTCTAAGACATCCAAmplification of BECN1
GST-BECN1-RCGGGATCCTTTGTTATAAAACTGTGAGGATACCC
GST-HERC5-FCG GGATCC ATGGAGCGGAGACCACGGAGAmplification of HERC5
GST-HERC5-RCCG CTCGAG TCAGCCAAATCCCCTGTGGTT
  1. Underlines show mutagenesis sites.