Skip to main content

Table 4 Primers used in ddPCR to validate the expressions of a small subgroup of identified miRNAs, which were determined by small RNA_Seq analysis

From: Marek’s disease vaccines-induced differential expression of known and novel microRNAs in primary lymphoid organ bursae of White Leghorn

miRNA Sequence Forward primer (5′ → 3′) Reverse primer (5′ → 3′)
gga-miR-31 aggcaagatgttggcatagctg gcagaggcaagatgttggcat caggtccagtttttttttttttttcagcta
gga-miR-193b aactggcccacaaagtcccgct cgcagaactggcccacaaag gtccagtttttttttttttttagcgggact
gga-mir-140 accacagggtagaaccacggac cagaccacagggtagaacca aggtccagtttttttttttttttgtccgt
gga-mir-142 cataaagtagaaagcactact cagcgcagcataaagtagaaagca gcaggtccagtttttttttttttttagtagt
gga-miR-499 ttaagacttgtagtgatgttt agcgcagttaagacttgtagtgat agcaggtccagtttttttttttttttaaacat
gga-mir-153 ttgcatagtcacaaaagtgatc gcgcagttgcatagtcacaaaag ccaggtccagtttttttttttttttgatca
gga-mir-1677 ttgacttcagtaggagcaggatt gcagttgacttcagtaggagca gcaggtccagtttttttttttttttaatcct
gga-mir-1769 agtgtgaaatctgcctgaaagt gcagagtgtgaaatctgcctga gcaggtccagtttttttttttttttactttc
novelMiR_142 agccggggatgatttctgcct cgcagagccggggatgatt aggtccagtttttttttttttttaggcagaa
novelMiR-5 gtagtcgtggccgagtggttaag ggtagtcgtggccgagtg gcaggtccagtttttttttttttttcttaac