Skip to main content

Table 1 Primers for RT-qPCR and plasmid construction

From: Porcine sialoadhesin suppresses type I interferon production to support porcine reproductive and respiratory syndrome virus infection

Primers Sequence (5′–3′)
pig GAPDH-Forward CCTTCCGTGTCCCTACTGCCAAC
pig GAPDH-Reverse GACGCCTGCTTCACCACCTTCT
pig IFN-β-Forward TGCAACCACCACAATTCC
pig IFN-β-Reverse CTGAGAATGCCGAAGATCTG
pig IFN-α-Forward GCCTCCTGCACCAGTTCTACA
pig IFN-α-Reverse TGCATGACACAGGCTTCCA
poSn-Forward CGTGTTGTGGCCTCTTCTCT
poSn-Reverse CACGTTGCAAGTCAGGTTGG
pig DAP12-Forward ACCCGGAAACAACACATCGC
pig DAP12-Reverse TACTGCCTCTGTGTGTTGAGG
PRRSV-ORF7-Forward AAACCAGTCCAGAGGCAAGG
PRRSV-ORF7-Reverse GCAAACTAAACTCCACAGTGTAA
poSn-infusion-Forward CTGGCTAGTTAAGCTATGGACTTCCTGCTCCTGCT
poSn-infusion-Reverse GCCCTCTAGACTCGAGGACTGTGCTTTTCACAGA
poSn-ECD-infusion-Reverse GCCCTCTAGACTCGAGGTGCTGGAACAGATGCA
poSn-TCD-Forward CCAAGCTTGCCACCATGCTTCTCTGGTTCCT
poSn-TCD-Reverse CCGCTCGAGGACTGTGCTTTTCACAGACTG
DAP12-Forward CCCAAGCTTGCCACCATGGGAAGACTGGGGCCAT
DAP12-XhoI-Reverse CCGCTCGAGTCACTTGTAGTACTGCCGCTGGGTA
DAP12-ΔICD-Forward CGGAATTCTCAGAGAGAATGCAGCTGCT
DAP12-ΔICD-Reverse GCTCTAGATCACACAGCCAGGGCGAT
DAP12-ΔECD-Forward CGGAATTCTGGCATCCTGGCG
DAP12-ΔECD-Reverse GCTCTAGATTTGTAATACTGCCTCTGTGTGTTG
DAP12(D50A)-Forward GGGGATCTGGTGCTGGCCCTCCTCATCGCCCTG
DAP12(D50A)-Reverse CAGGGCGATGAGGAGGGCCAGCACCAGATCCCC
DAP12-ΔTM1-Forward GCTGCTCCGCCGTGAGCCCCCTGGGGGATCTGGTGCTGAC
DAP12-ΔTM1-Reverse GTCAGCACCAGATCCCCCAGGGGGCTCACGGCGGAGCAGC
DAP12-ΔTM2-Forward GCATCCTGGCGGGGATCGTGCTCCTCATCGCCCTGGCTGT
DAP12-ΔTM2-Reverse ACAGCCAGGGCGATGAGGAGCACGATCCCCGCCAGGATGC
DAP12-ΔTM3-Forward TGGGGGATCTGGTGCTGACCTACTCCCTGGGTCGGCTGGT
DAP12-ΔTM3-Reverse ACCAGCCGACCCAGGGAGTAGGTCAGCACCAGATCCCCCA