Skip to main content

Table 1 Primers used for qPCR

From: Antiviral activity of interleukin-11 as a response to porcine epidemic diarrhea virus infection

GenesPrimersSequence (5′–3′)*Accession
GAPDHForwardTCATCATCTCTGCCCCTTCTNM_001206359.1
 ReverseGTCATGAGTCCCTCCACGAT
PEDV-MForwardATGCATGGGCTAGCTTCCAGJX002693.1
 ReverseGTAGTGAGAAGCGCGTCAGT
IL-11(Pig)
(PCR)
ForwardGTGGTGGTGCTCGAGCAGCCGAGTCTTXM_021095008.1
ReverseGCTGATATCGGATCCATGAACAGTGTTT
IL-11(Pig)
(qPCR)
ForwardCCGCACAGCTGAGAGACAAATXM_021095008.1
ReverseGCCTCAGGTAGGAAAACAGGT
IL-11 (Green monkey)ForwardCCCGAGTGTGCTGACAAGGXM_007998152.1
ReverseCCTGAAGACCCTGGAGCCTG
Bcl-2ForwardATGTGTGTGGAGAGCGTCAAXM_008013867.1
 ReverseGGGCCGTACAGTTCCACAAA
Bcl-WForwardGCAGGTATTGGTGAGTCGGAXM_008020066.1
 ReverseATAAACCTTGCACCTCTCCCAG
MCL-1ForwardGCAGGTATTGGTGAGTCGGAXM_008019267.1
 ReverseGCTCTGGAGACCTTACGACG