Skip to main content

Table 2 Primers used in this study

From: Lsr operon is associated with AI-2 transfer and pathogenicity in avian pathogenic Escherichia coli

PrimersOligonucleotide sequence (5′ to 3′)DescriptionProduct size (bp)
lsrK-FCTATAACCCAGGCGCTTTCCATAPartial sequence of lsrK1593
lsrK-RATGGCTCGACTCTTTACCCTTTC
lsrR-FTTAACTACGTAAAATCGCCGCTGPartial sequence of lsrR954
lsrR-RATGACAATCAACGATTCGGCAAT
LsrA-FATGCAAACGAGTGATACCCGCGCPartial sequence of lsrA1539
lsrA-RACTTCAGCATGACGCCTCCTGAC
lsrC-FCTGAAGTTTATTCAGAACAACCGTGPartial sequence of lsrC826
lsrC-RTATCGATCTGCGTCAGGAACCAT
lsrD-FGCCGCATAATGCGTATTCGCTACPartial sequence of lsrD1003
lsrD-RCTTTATGGCAATGGGTTATTGGC
lsrB-FATGACACTTCATCGCTTTAAGAaPartial sequence of lsrB826
lsrB-RCTGAAATTTTGCCTTGCTGAACa
lsrF-FGTAAAGATTTTCGTACCGATCAACPartial sequence of lsrF657
lsrF-RTTTTACCGCCAGCAATAACAATG
lsrG-FATGCACGTCACACTGGTTGAAATPartial sequence of lsrG291
lsrG-RTCACGGCATCAAACCATTGAACA
APEC94lsr-FTCCCTTGAATATCGTACTGGUsing for DNA sequencing of lsr operon 
APEC94lsr-RTGCGCTTCGATGTCTTAC
pCold-F1CCCAAGCTTGAAATCGTATTTGCCGATUsing for identification of lsrB-APEC recombinant plasmid1150
pCold-RGGCAGGGATCTTAGATTCTG
lsr-UFTCTAAAAGAAGGGAAATAAGbThe upstream sequence of lsr operon763
lsr-URCCAGCCTACA GCATGGTACAAGCTGAATC
lsr-CFTGTACCATGCTGTAGGCTGGAGCTGCTTChloramphenicol resistance cassette (cat)1013
lsr-CRCATTGAACAGCATATGAATATCCTCCTTAGTTC
lsr-DFTATTCATATGCTGTTCAATGGGTTGATGCThe downstream sequence of lsr operon638
lsr-DRTGGTGATAGTAGGTGGTTCGb
PstI-lsr-CFAAAACTGCAGGGTCTGTATTGAGTGTTAGTTGGAGGTGGGcThe lsr operon complement sequence9440
PstI-lsr-CRAAAACTGCAGCAGTTGCGGATGTCTGCTTc
LsrB-BamHI-FCGCGGATCCATGACACTTCATCGCTTTAdThe ORF sequence of lsrB1023
LsrB-HindIII-RCCACTTTCAACGAGCTGATGe
fimH-RTFGTGCCAATTCCTCTTACCGTTPartial DNA sequence of fimbrial protein FimH165
fimH-RTRTGGAATAATCGTACCGTTGCG
fliD-RTFTTCAGACGCAGTTGAAATCGPartial DNA sequence of flagellar filament capping protein FliD184
fliD-RTRTTACCATCGCCAACAATCAA
flhA-RTFCGGCATCGTACTCTGGAACTPartial DNA sequence of flagellar biosynthesis gene flhA172
flhA-RTRCATTACCCATCCGTTCGTTC
dosP-RTFATAAACCCACGCCCATATCAPartial DNA sequence of oxygen-sensing cyclic-di-GMP phosphodiesterase DosP194
dosP-RTRGGCGTTATCCGTGAACTTGT
pgaA-RTFGGCAATGGTCTCCTTGTGATPartial DNA sequence of poly-beta-1,6 N-acetyl-d-glucosamine export porin PgaA195
pgaA-RTRGATCATCTTGGCGCGTTATT
fhuD-RTFAACTATCGCCTGTGGGTCAGPartial DNA sequence of iron-hydroxamate transporter substrate-binding subunit fhuD153
fhuD-RTRTGCCAGCATTTCTGATGAAG
dnaE-RTFGATTGAGCGTTATGTCGGAGGCPartial DNA sequence of the internal control dnaE80
dnaE-RTRGCCCCGCAGCCGTGAT
  1. aA 826-bp PCR product was amplified from wild-type strain APEC94 but no PCR product was obtained from mutant strain APEC94Δlsr(Cm) using primers lsrB-F/lsrB-R.
  2. bA 2414-bp PCR product was amplified from mutant strain APEC94Δlsr(Cm) but no product was amplified from wild-type strain APEC94 in a limited amplification time using primers lsr-UF/lsr-DR.
  3. cPstI restriction sites are underlined.
  4. dBamHI restriction sites are underlined.
  5. eHindIII restriction sites are underlined.