Skip to main content

Table 2 shRNAs used in this study

From: Bovine ephemeral fever virus triggers autophagy enhancing virus replication via upregulation of the Src/JNK/AP1 and PI3K/Akt/NF-κB pathways and suppression of the PI3K/Akt/mTOR pathway

Target gene Cat. no Tube ID Target sequence (5′–3′)
Akt TRCN0000010163 CGAGTTTGAGTACCTGAAGCT
Atg7 TG314609 GI358429 TGCCAGCTCGCTTAACATTGGAGTTCAGT
LC3-II TG503902 GI515131 TGGACAAGACCAAGTTCCTGGTGCCTGAC
LAMP2 TG311794 GI347172 CCAATTATAGTTGGTGCTGGTCTTTCAGG
Beclin 1 TG314484 GI357930 TGTCAGAACTACAAACGCTGTTTGGAGAT