Skip to main content

Table 2 Primers used for RT-PCR and qRT-PCR in human cells

From: Role of neuromedin B and its receptor in the innate immune responses against influenza A virus infection in vitro and in vivo

Primer names GenBank accession no. Sequence (5′–3′)
NMB sense NM_021077.4 TAAAGAAGGCTCTGGGCGTG
NMB antisense GGTGACCCAGCCAGAAATCA
NMBR sense NM_002511.3 ACCTAAATCGTGGGCGTTCA
NMBR antisense GGCAGGAAATCCCTTTCCCA
GAPDH sense NM_002046.7 TGGGTGTGAACCATGAGAAGT
GAPDH antisense AAGGCCATGCCAGTGAGCTT
IL-6 sense NM_000600.5 ACAAATTCGGTACATCCTCGAC
IL-6 antisense TGGCTTGTTCCTCACTACTCT
IFN-α sense J00210.1 TGATCTGCCTCAAACCCACA
IFN-α antisense ATCTGCTGGATCATCTCATGG